1 Description


Read distribution plot - plot shows number of reads assigned during read grouping
Filtered Reads - plot shows percentage of assigned reads that have been recognized as PRIMER DIMERS or filtered based on low alignment score
Cutting rates - plot gives overview of percentage of reads (not filtered as PRIMER DIMER) that have cut
Frameshift - plot shows what percentage of reads have frameshift
Frameshift overlapping - shows what percentage of reads have frameshift counting only deletions and insertions that overlap expected cut site (should be more accurate when controls are not available)
Read heterogeneity plot - shows what is the share of each of the unique reads in total count of all reads. The more yellow each row, the less heterogeneity in the reads, more black means reads don’t repeat often and are unique


2 guideRNA Summary


2.1 Read distribution

2.2 Filtered Reads

2.3 Indel rates

2.4 Frameshift

2.5 Heterogeneity of reads


3 Alignments plots


3.1 Guide AGGTGGTCAGGGAACTGG

3.1.1 Deletions

3.1.2 Insertions

3.1.3 Mismatches

[1] “No mismatches to plot.”

3.2 Guide TGACCCTCTGCCAACACAAGGGG

3.2.1 Deletions

3.2.2 Insertions

[1] “No insertions to plot.”

3.2.3 Mismatches

[1] “No mismatches to plot.”

3.3 Guide GTCCCTGCAACATTAAAGGCCGG

3.3.1 Deletions

[1] “No deletions to plot.”

3.3.2 Insertions

3.3.3 Mismatches

[1] “No mismatches to plot.”