Computation of melting temperature of nucleic acid duplexes with rmelting

  1. Division of Germplasm Conservation, ICAR-National Bureau of Plant Genetic Resources, New Delhi.

  1. Division of Genetics, ICAR-Indian Agricultural Research Institute, New Delhi.

logo

Introduction

The R package rmelting is an interface to the MELTING 5 program (Le Novère, 2001; Dumousseau et al., 2012) to compute melting temperatures of nucleic acid duplexes (DNA/DNA, DNA/RNA, RNA/RNA or 2’-O-MeRNA/RNA) along with other thermodynamic parameters such as hybridisation enthalpy and entropy.

Melting temperatures are computed by Nearest-neighbour methods for short sequences or approximative estimation formulae for long sequences. Apart from these, multiple corrections are available to take into account the presence of Cations (Na, Tris, K and Mg) or denaturing agents (DMSO and formamide).

Installation

The package can be installed from Bioconductor as follows.

if (!"BiocManager" %in% rownames(installed.packages())) 
  install.packages("BiocManager")
BiocManager::install("rmelting")

The development version can be installed from github as follows.

if (!require('devtools')) install.packages('devtools')
devtools::install_github("aravind-j/rmelting")

Then the package can be loaded as follows.

library(rmelting)

Basic usage

Melting temperatures are computed in rmelting through the core function melting which takes a number of arguments (see ?melting). The following are the essential arguments which are mandatory for computation.

  • sequence
    • 5’ to 3’ sequence of one strand of the nucleic acid duplex as a character string. Recognises A, C, G, T, U, I, X_C, X_T, A*, AL, TL, GL and CL (Table 1). U and T are not considered identical.

Table 1: Recognized sequences

Code Type
A Adenine
C Cytosine
G Guanine
T Thymine
U Uracil
I Inosine
X_C Trans azobenzenes
X_T Cis azobenzenes
A* Hydroxyadenine
AL Locked nucleic acid
TL ’’
GL ’’
CL ’’
  • Comp.sequence
    • Mandatory if there are mismatches, inosine(s) or hydroxyadenine(s) between the two strands. If not specified, it is computed as the complement of sequence. Self-complementarity in sequence is detected even though there may be (are) dangling end(s) and comp.sequence is computed.
  • nucleic.acid.conc
    • In molar concentration (M or mol L-1).
  • Na.conc, Mg.conc, Tris.conc, K.conc
    • At least one cation (Na, Mg, Tris, K) concentration is mandatory, the other agents(dNTP, DMSO, formamide) are optional.
  • hybridisation.type
    • The possible options for hybridisation type are as follows (Table 2).

Table 2: Hybridisation type options

Option Sequence Complementary sequence
dnadna DNA DNA
rnarna RNA RNA
dnarna DNA RNA
rnadna RNA DNA
mrnarna 2-o-methyl RNA RNA
rnamrna RNA 2-o-methyl RNA

With these arguments, the melting temperature can be computed as follows.

melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1)
## [1] 73.35168

Only the melting temperature is given as a console output. However, the output can be assigned to an object which contains the details of the environment, options and the thermodynamics results as a list.

# Get output as list
out <- melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
               hybridisation.type = "dnadna", Na.conc = 1)
# Environment output
out$Environment
## $Sequence
## [1] "CAGTGAGACAGCAATGGTCG"
## 
## $`Complementary sequence`
## [1] "GTCACTCTGTCGTTACCAGC"
## 
## $`Nucleic acid concentration (M)`
## [1] 2e-06
## 
## $`Hybridization type`
## [1] "dnadna"
## 
## $`Na concentration (M)`
## [1] 1
## 
## $`Mg concentration (M)`
## [1] 0
## 
## $`Tris concentration (M)`
## [1] 0
## 
## $`K concentration (M)`
## [1] 0
## 
## $`dNTP concentration (M)`
## [1] 0
## 
## $`DMSO concentration (%)`
## [1] 0
## 
## $`Formamide concentration (M or %)`
## [1] 0
## 
## $`Self complementarity`
## [1] FALSE
## 
## $`Correction factor`
## [1] 4
# Options used
out$Options
## $`Approximative formula`
## [1] NA
## 
## $`Nearest neighbour model`
## [1] NA
## 
## $`GU model`
## [1] NA
## 
## $`Single mismatch model`
## [1] NA
## 
## $`Tandem mismatch model`
## [1] NA
## 
## $`Single dangling end model`
## [1] NA
## 
## $`Double dangling end model`
## [1] NA
## 
## $`Long dangling end model`
## [1] NA
## 
## $`Internal loop model`
## [1] NA
## 
## $`Single bulge loop model`
## [1] NA
## 
## $`Long bulge loop model`
## [1] NA
## 
## $`CNG repeats model`
## [1] NA
## 
## $`Inosine bases model`
## [1] NA
## 
## $`Hydroxyadenine bases model`
## [1] NA
## 
## $`Azobenzenes model`
## [1] NA
## 
## $`Locked nucleic acids model`
## [1] NA
## 
## $`Ion correction method`
## [1] NA
## 
## $`Na equivalence correction method`
## [1] NA
## 
## $`DMSO correction method`
## [1] NA
## 
## $`Formamide correction method`
## [1] NA
## 
## $Mode
## [1] NA
# Thermodynamics results
out$Results
## $`Enthalpy (cal)`
## [1] -159000
## 
## $`Entropy (cal)`
## [1] -430
## 
## $`Enthalpy (J)`
## [1] -664620
## 
## $`Entropy (J)`
## [1] -1797.4
## 
## $`Melting temperature (C)`
## [1] 73.35168

The command for the MELTING 5 java version is saved as an attribute in the list out and can be retrieved as follows.

# Command for MELTING 5
attributes(out)$command
## [1] "-S CAGTGAGACAGCAATGGTCG -H dnadna -P 2e-06 -E Na=1 -T 60"

Melting temperature computation

Melting temperature is computed by either approximative or nearest neighbour methods according to the length of the oligonucleotide sequences. For longer sequences (longer than the threshold value, the threshold value set by size.threshold with the default value 60) approximative method is used, while for others, nearest neighbour method is used.

Approximative methods

The approximative method for computation can be specified by the argument method.approx. The available methods are given in Table 3.

Table 3: Details of approximative methods

Formula Type Limits/Remarks Reference
ahs01 DNA No mismatch Ahsen et al. (2001)
che93 DNA No mismatch; Na=0, Mg=0.0015, Tris=0.01, K=0.05 Marmur and Doty (1962)
che93corr DNA No mismatch; Na=0, Mg=0.0015, Tris=0.01, K=0.05 Marmur and Doty (1962)
schdot DNA No mismatch Wetmur (1991), Marmur and Doty (1962), Chester and Marshak (1993), Schildkraut and Lifson (1965), Wahl et al. (1987), Britten et al. (1974), Hall et al. (1980)
owe69 DNA No mismatch Owen et al. (1969), Frank-Kamenetskii (1971), Blake (1996), Blake and Delcourt (1998)
san98 DNA No mismatch SantaLucia (1998), Ahsen et al. (2001)
wetdna91* DNA Wetmur (1991)
wetrna91* RNA Wetmur (1991)
wetdnarna91* DNA/RNA Wetmur (1991)
* Default method for computation.

Examples

    DNA:TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
    DNA:AGATTACACGACAATCTACATAGGTCTCTATCGGCTCGTATTTGAAGTTGTGTGCTCTGCAACTAACCTAAATTGGTATC

    RNA:UUAAUCUCCGUCAUCUUUAAGCCGUGGAGAGACUGUAGACUUGAACAGGGGUAAGCGGAGGCACGUAGGAUUCACAUCAU
        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
    RNA:AAUUAGAGGCAGUAGAAAUUCGGCACCUCUCUGACAUCUGAACUUGUCCCCAUUCGCCUCCGUGCAUCCUAAGUGUAGUA
    
    DNA:TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG
        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
    RNA:AGAUUACACGACAAUCUACAUAGGUCUCUAUCGGCUCGUAUUUGAAGUUGUGUGCUCUGCAACUAACCUAAAUUGGUAUC
    
# Long Nucleotide sequence
DNAseq <- c("TCTAATGTGCTGTTAGATGTATCCAGAGATAGCCGAGCATAAACTTCAACACACGAGACGTTGATTGGATTTAACCATAG")
RNAseq <- c("UUAAUCUCCGUCAUCUUUAAGCCGUGGAGAGACUGUAGACUUGAACAGGGGUAAGCGGAGGCACGUAGGAUUCACAUCAU")

# Approximative method - default (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1)
## [1] 87.82455
# Approximative method - wetdna91 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1,
        method.approx = "wetdna91")
## [1] 87.82455
# Approximative method - ahs01 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1,
        method.approx = "ahs01")
## [1] 87.325
# Approximative method - che93 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1,
        method.approx = "che93")
## [1] 77.575
# Approximative method - che93corr (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1,
        method.approx = "che93corr")
## [1] 79.0125
# Approximative method - schdot (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1,
        method.approx = "schdot")
## [1] 89.4625
# Approximative method - owe69 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1,
        method.approx = "owe69")
## [1] 100.96
# Approximative method - san98 (DNA/DNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1,
        method.approx = "san98")
## [1] 86.9
# Approximative method - default (RNA/RNA)
melting(sequence = RNAseq, nucleic.acid.conc = 2e-06,
        hybridisation.type = "rnarna", Na.conc = 1)
## [1] 101.1745
# Approximative method - wetrna91 (RNA/RNA)
melting(sequence = RNAseq, nucleic.acid.conc = 2e-06,
        hybridisation.type = "rnarna", Na.conc = 1,
        method.approx = "wetrna91")
## [1] 101.1745
# Approximative method - wetdnarna91 (DNA/RNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnarna", Na.conc = 1)
## [1] 88.92455
# Approximative method - wetdnarna91 (DNA/RNA)
melting(sequence = DNAseq, nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnarna", Na.conc = 1,
        method.approx = "wetdnarna91")
## [1] 88.92455

Nearest neighbour methods

Perfectly matching sequences

The nearest neighbour model for computation in case of perfectly matching sequences can be specified by the argument method.nn. The available methods are given in Table 4.

Table 4: Details of nearest neighbour methods for perfectly matching sequences

Model Type Limits/Remarks Reference
all97* DNA Allawi and SantaLucia (1997)
bre86 DNA Breslauer et al. (1986)
san04 DNA SantaLucia and Hicks (2004)
san96 DNA SantaLucia et al. (1996)
sug96 DNA Sugimoto et al. (1996)
tan04 DNA Tanaka et al. (2004)
fre86 RNA Freier et al. (1986)
xia98* RNA Xia et al. (1998)
sug95* DNA/ RNA SantaLucia et al. (1996)
tur06* 2’-O-MeRNA/ RNA A sodium correction (san04) is automatically applied to convert the entropy (Na = 0.1M) into the entropy (Na = 1M) Kierzek et al. (2006)
* Default method for computation.

Examples

    DNA:CAGTGAGACAGCAATGGTCG
        ||||||||||||||||||||
    DNA:GTCACTCTGTCGTTACCAGC

    RNA:CAGUGAGACAGCAAUGGUCG
        ||||||||||||||||||||
    RNA:GUCACUCUGUCGUUACCAGC
    
    DNA:CAGTGAGACAGCAATGGTCG
        ||||||||||||||||||||
    RNA:GUCACUCUGUCGUUACCAGC
    
# Nearest neighbour method - default (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1)
## [1] 73.35168
# Nearest neighbour method - all97 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1, method.nn = "all97")
## [1] 73.35168
# Nearest neighbour method - bre86 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1, method.nn = "bre86")
## [1] 83.2203
# Nearest neighbour method - san04 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san04")
## [1] 73.30191
# Nearest neighbour method - san96 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san96")
## [1] 75.7102
# Nearest neighbour method - sug96 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1, method.nn = "sug96")
## [1] 78.17556
# Nearest neighbour method - tan04 (DNA/DNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1, method.nn = "tan04")
## [1] 71.31413
# Nearest neighbour method - default (RNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "rnarna", Na.conc = 1)
## [1] 86.77685
# Nearest neighbour method - xia98 (RNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "rnarna", Na.conc = 1, method.nn = "xia98")
## [1] 86.77685
# Nearest neighbour method - fre86 (RNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "rnarna", Na.conc = 1, method.nn = "fre86")
## [1] 83.81257
# Nearest neighbour method - default (mRNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "mrnarna", Na.conc = 1)
## [1] 99.01986
# Nearest neighbour method - tur06 (mRNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGUGAGACAGCAAUGGUCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "mrnarna", Na.conc = 1, method.nn = "tur06")
## [1] 99.01986
# Nearest neighbour method - default (DNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnarna", Na.conc = 1)
## [1] 66.77049
# Nearest neighbour method - sug95 (DNA/RNA: No Self-Complimentarity)
melting(sequence = "CAGTGAGACAGCAATGGTCG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnarna", Na.conc = 1, method.nn = "sug95")
## [1] 66.77049

Self complementarity for perfect matching sequences or sequences with dangling ends is detected automatically. However it can be enforced by the argument force.self = TRUE.

Examples

    DNA:CATATGGCCATATG
        ||||||||||||||
    DNA:GTATACCGGTATAC

    RNA:AUGUACAU
        ||||||||
    RNA:UACAUGUA
# Nearest neighbour method - default (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1)
## [1] 56.00644
# Nearest neighbour method - all97 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1, method.nn = "all97")
## [1] 56.00644
# Nearest neighbour method - bre86 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1, method.nn = "bre86")
## [1] 63.44605
# Nearest neighbour method - san04 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san04")
## [1] 57.80792
# Nearest neighbour method - san96 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1, method.nn = "san96")
## [1] 55.0921
# Nearest neighbour method - sug96 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1, method.nn = "sug96")
## [1] 59.06213
# Nearest neighbour method - tan04 (DNA/DNA: Self-Complimentarity)
melting(sequence = "CATATGGCCATATG", nucleic.acid.conc = 2e-06,
        hybridisation.type = "dnadna", Na.conc = 1, method.nn = "tan04")
## [1] 55.65824
# Nearest neighbour method - default (RNA/RNA: Self-Complimentarity)
melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06,
        hybridisation.type = "rnarna", Na.conc = 1)
## [1] 30.27015
# Nearest neighbour method - xia98 (RNA/RNA: Self-Complimentarity)
melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06,
        hybridisation.type = "rnarna", Na.conc = 1, method.nn = "xia98")
## [1] 30.27015
# Nearest neighbour method - fre86 (RNA/RNA: Self-Complimentarity)
melting(sequence = "AUGUACAU", nucleic.acid.conc = 2e-06,
        hybridisation.type = "rnarna", Na.conc = 1, method.nn = "fre86")
## [1] 31.48175

GU wobble base pairs effect

The nearest neighbour model for computation in case of sequences with GU wobble base pairs can be specified by the argument method.GU. The available methods are given in Table 5.

Table 5: Details of methods for sequences with GU wobble base pairs

Model Type Limits/Remarks Reference
tur99 RNA Mathews et al. (1999)
ser12* RNA Chen et al. (2012)
* Default method for computation.

Examples

    RNA:CCAGCGUCCU
        ||||||||||
    RNA:GGTCGCAGGA
# GU wobble base pairs effect - default (RNA/RNA)
melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001,
        hybridisation.type = "rnarna", Na.conc = 1)
## [1] 79.46955
# GU wobble base pairs effect - ser12 (RNA/RNA)
melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001,
        hybridisation.type = "rnarna", Na.conc = 1, method.GU = "ser12")
## [1] 79.46955
# GU wobble base pairs effect - tur99 (RNA/RNA)
melting(sequence = "CCAGCGUCCU", nucleic.acid.conc = 0.0001,
        hybridisation.type = "rnarna", Na.conc = 1, method.GU = "tur99")
## [1] 79.46955

Single mismatch effect

The nearest neighbour model for computation in case of sequences with a single mismatch can be specified by the argument method.singleMM. The available methods are given in Table 6.

Table 6: Details of methods for sequences with single mismatch

Model Type Limits/Remarks Reference
allsanpey* DNA Allawi and SantaLucia (1997), Allawi and SantaLucia (1998a), Allawi and SantaLucia (1998b), Allawi and SantaLucia (1998c), Peyret et al. (1999)
wat11* DNA/RNA Watkins et al. (2011)
tur06 RNA Lu et al. (2006)
zno07* RNA Davis and Znosko (2007)
zno08 RNA At least one adjacent GU base pair. Davis and Znosko (2008)
* Default method for computation.

Examples

    DNA:CAACTTGATATTAATA
        |||||||| |||||||
    DNA:GTTGAACTCTAATTAT

    RNA:GACAGGCUG
        |||| ||||
    RNA:CUGUGCGAC
        
    DNA:CCATAACTACC
        |||| ||||||
    RNA:GGUAAUGAUGG
# Single mismatch effect - default (DNA/DNA)
melting(sequence = "CAACTTGATATTAATA", comp.sequence = "GTTGAACTCTAATTAT",
        nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1)
## [1] 51.97499
# Single mismatch effect - allsanpey (DNA/DNA)
melting(sequence = "CAACTTGATATTAATA", comp.sequence = "GTTGAACTCTAATTAT",
        nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
        Na.conc = 1, method.singleMM = "allsanpey")
## [1] 51.97499
# Single mismatch effect - default (RNA/RNA)
melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1)
## [1] 54.40363
# Single mismatch effect - zno07 (RNA/RNA)
melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.singleMM = "zno07")
## [1] 54.40363
# Single mismatch effect - zno08 (RNA/RNA)
melting(sequence = "CAGUACGUC", comp.sequence = "GUCGGGCAG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.singleMM = "zno08")
## [1] 38.26298
# Single mismatch effect - tur06 (RNA/RNA)
melting(sequence = "GACAGGCUG", comp.sequence = "CUGUGCGAC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.singleMM = "tur06")
## [1] 58.27825
# Single mismatch effect - default (DNA/RNA)
melting(sequence = "CCATAACTACC", comp.sequence = "GGUAAUGAUGG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnarna", Na.conc = 1)
## [1] 40.32976
# Single mismatch effect - wat11 (DNA/RNA)
melting(sequence = "CCATAACTACC", comp.sequence = "GGUAAUGAUGG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnarna",
        Na.conc = 1, method.singleMM = "wat11")
## [1] 40.32976

Tandem mismatches effect

The nearest neighbour model for computation in case of sequences with tandem mismatches can be specified by the argument method.tandemMM. The available methods are given in Table 7.

Table 7: Details of methods for sequences with tandem mismatches

Model Type Limits/Remarks Reference
allsanpey* DNA Only GT mismatches and TA/TG mismatches. Allawi and SantaLucia (1997), Allawi and SantaLucia (1998a), Allawi and SantaLucia (1998b), Allawi and SantaLucia (1998c), Peyret et al. (1999)
tur99* RNA No adjacent GU or UG base pairs. Mathews et al. (1999), Lu et al. (2006)
* Default method for computation.

Examples

    DNA:GACGTTGGAC
        ||||  ||||
    DNA:CTGCGGCCTG

    RNA:GAGCGGAG
        |||  |||
    RNA:CUCCACUC
# Tandem mismatches effect - default (DNA/DNA)
melting(sequence = "GACGTTGGAC", comp.sequence = "CTGCGGCCTG",
        nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna", Na.conc = 1)
## [1] 50.20175
# Tandem mismatches effect - allsanpey (DNA/DNA)
melting(sequence = "GACGTTGGAC", comp.sequence = "CTGCGGCCTG",
        nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
        Na.conc = 1, method.tandemMM = "allsanpey")
## [1] 50.20175
# Tandem mismatches effect - default (RNA/RNA)
melting(sequence = "GAGCGGAG", comp.sequence = "CUCCACUC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna", Na.conc = 1)
## [1] 21.07224
# Tandem mismatches effect -  tur06 (RNA/RNA)
melting(sequence = "GAGCGGAG", comp.sequence = "CUCCACUC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.tandemMM = "tur99")
## [1] 21.07224

Single dangling end effect

The nearest neighbour model for computation in case of sequences with a single dangling end can be specified by the argument method.single.dangle. The available methods are given in Table 8.

Table 8: Details of methods for sequences with single dangling end

Model Type Limits/Remarks Reference
bom00* DNA Bommarito et al. (2000)
sugdna02 DNA Only terminal poly A self complementary sequences. Ohmichi et al. (2002)
sugrna02 RNA Only terminal poly A self complementary sequences. Ohmichi et al. (2002)
ser08* RNA Only 3’ UA, GU and UG terminal base pairs only 5’ UG and GU terminal base pairs. O’Toole et al. (2006), Miller et al. (2008)
* Default method for computation.

Examples

    DNA:-GTAGCTACA
         |||||||| 
    DNA:ACATCGATG-

    RNA:-GGCGCUG
         |||||||
    RNA: CCGCGAC
        
    DNA:-GGCGCUG
         |||||||
    RNA: CCGCGAC
# Single dangling end effect - default (DNA/DNA)
melting(sequence = "-GTAGCTACA",
        nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
        Na.conc = 1)
## [1] 52.58935
# Single dangling end effect - bom00 (DNA/DNA)
melting(sequence = "-GTAGCTACA",
        nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
        Na.conc = 1, method.single.dangle = "bom00")
## [1] 52.58935
# Single dangling end effect - sugdna02 (DNA/DNA)
melting(sequence = "-GTAGCTACA",
        nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
        Na.conc = 1, method.single.dangle = "sugdna02")
## [1] 50.78548
# Single dangling end effect - default (RNA/RNA)
melting(sequence = "-GGCGCUG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1)
## [1] 65.7647
# Single dangling end effect -  ser08 (RNA/RNA)
melting(sequence = "-GGCGCUG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.single.dangle = "ser08")
## [1] 65.7647
# Single dangling end effect -  sugrna02 (RNA/RNA)
melting(sequence = "-GGCGCUG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.single.dangle = "sugrna02")
## [1] 65.7647

Double dangling end effect

The nearest neighbour model for computation in case of sequences with a double or secondary dangling ends can be specified by the argument method.double.dangle. The available methods are given in Table 9.

Table 9: Details of methods for sequences with double dangling ends

Model Type Limits/Remarks Reference
sugdna02* DNA Only terminal poly A self complementary sequences. Ohmichi et al. (2002)
sugrna02 RNA Only terminal poly A self complementary sequences. Ohmichi et al. (2002)
ser05 RNA Depends on the available thermodynamic parameters for single dangling end. O’Toole et al. (2005)
ser06* RNA O’Toole et al. (2006)
* Default method for computation.

Examples

    DNA:--ATGCATAA
          ||||||
    DNA:AATACGTA--

    RNA:--AUGCAUAA
          ||||||
    RNA:AAUACGUA--
# Double dangling end effect - default (DNA/DNA)
melting(sequence = "--ATGCATAA",
        nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
        Na.conc = 1)
## [1] 44.88615
# Double dangling end effect - sugdna02 (DNA/DNA)
melting(sequence = "--ATGCATAA",
        nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
        Na.conc = 1, method.double.dangle = "sugdna02")
## [1] 44.88615
# Double dangling end effect - default (RNA/RNA)
melting(sequence = "--AUGCAUAA",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1)
## [1] 42.79724
# Double dangling end effect -  ser06 (RNA/RNA)
melting(sequence = "--AUGCAUAA",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.double.dangle = "ser06")
## [1] 42.79724
# Double dangling end effect -  sugrna02 (RNA/RNA)
melting(sequence = "--AUGCAUAA",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.double.dangle = "sugrna02")
## [1] 41.82788
# Double dangling end effect -  ser05 (RNA/RNA)
melting(sequence = "--AUGCAUAA",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.double.dangle = "ser05")
## [1] 42.78815

Long dangling end effect

The nearest neighbour model for computation in case of sequences with a double or secondary dangling ends can be specified by the argument method.long.dangle. The available methods are given in Table 10.

Table 10: Details of methods for sequences with long dangling ends

Model Type Limits/Remarks Reference
sugdna02* DNA Only terminal poly A self complementary sequences. Ohmichi et al. (2002)
sugrna02* RNA Only terminal poly A self complementary sequences. Ohmichi et al. (2002)
* Default method for computation.

Examples

    DNA:----GCATATGCAAAA
            |||||||| 
    DNA:AAAACGTATACG----

    RNA:AAAAGCAUAUGC----
            ||||||||
    RNA:----CGUAUACGAAAA
# Long dangling end effect - default (DNA/DNA)
melting(sequence = "----GCATATGCAAAA",
        nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
        Na.conc = 1)
## [1] 55.69854
# Long dangling end effect - sugdna02 (DNA/DNA)
melting(sequence = "----GCATATGCAAAA",
        nucleic.acid.conc = 0.0004, hybridisation.type = "dnadna",
        Na.conc = 1, method.long.dangle = "sugdna02")
## [1] 55.69854
# Long dangling end effect - default (RNA/RNA)
melting(sequence = "AAAAGCAUAUGC----",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1)
## [1] 57.21314
# Long dangling end effect -  sugrna02 (RNA/RNA)
melting(sequence = "AAAAGCAUAUGC----",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.long.dangle = "sugrna02")
## [1] 57.21314

Internal loop effect

The nearest neighbour model for computation in case of sequences with an internal loop (more than two adjacent mismatches) can be specified by the argument method.internal.loop. The available methods are given in Table 11.

Table 11: Details of methods for sequences with internal loops

Model Type Limits/Remarks Reference
san04* DNA Missing asymmetry penalty. Not tested with experimental results. SantaLucia and Hicks (2004)
tur06 RNA Not tested with experimental results. Lu et al. (2006)
zno07* RNA Only for 1x2 loop. Badhwar et al. (2007)
* Default method for computation.

Examples

    DNA:GCGATTGGCACTTTGGTGAAC
        |||||    ||||||||||||
    DNA:CGCTACATATGAAACCACTTG

    RNA:GACAC-GCUG
        ||||  ||||
    RNA:CUGUAUCGAC
# Internal loop effect - default (DNA/DNA)
melting(sequence = "GCGATTGGCACTTTGGTGAAC", comp.sequence = "CGCTACATATGAAACCACTTG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1)
## [1] 84.09052
# Internal loop effect - san04 (DNA/DNA)
melting(sequence = "GCGATTGGCACTTTGGTGAAC", comp.sequence = "CGCTACATATGAAACCACTTG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1, method.internal.loop = "san04")
## [1] 84.09052
# Internal loop effect - default (RNA/RNA)
melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1)
## [1] 45.98713
# Internal loop effect -  zno07 (RNA/RNA)
melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.internal.loop = "zno07")
## [1] 40.49012
# Internal loop effect -  tur06 (RNA/RNA)
melting(sequence = "GACAC-GCUG", comp.sequence = "CUGUAUCGAC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.internal.loop = "tur06")
## [1] 45.98713

Single bulge loop effect

The nearest neighbour model for computation in case of sequences with a single bulge loop can be specified by the argument method.single.bulge.loop. The available methods are given in Table 12.

Table 12: Details of methods for sequences with single bulge loop

Model Type Limits/Remarks Reference
tan04* DNA Tan and Chen (2007)
san04 DNA Missing closing AT penalty. SantaLucia and Hicks (2004)
ser07 RNA Less reliable results. Some missing parameters. Blose et al. (2007)
tur06* RNA Lu et al. (2006)
* Default method for computation.

Examples

    DNA:TCGATTAGCGACACAGG
        |||||||| ||||||||
    DNA:AGCTAATC-CTGTGTCC

    RNA:GACUCUGUC
        |||| ||||
    RNA:CUGA-ACAG
# Single bulge loop effect - default (DNA/DNA)
melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1)
## [1] 71.12754
# Single bulge loop effect - tan04 (DNA/DNA)
melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1, method.single.bulge.loop = "tan04")
## [1] 71.12754
# Single bulge loop effect - san04 (DNA/DNA)
melting(sequence = "TCGATTAGCGACACAGG", comp.sequence = "AGCTAATC-CTGTGTCC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1, method.single.bulge.loop = "san04")
## [1] 62.0496
# Single bulge loop effect - default (RNA/RNA)
melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1)
## [1] 39.47787
# Single bulge loop effect -  tur06 (RNA/RNA)
melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.single.bulge.loop = "tur06")
## [1] 39.47787
# Single bulge loop effect -  ser07 (RNA/RNA)
melting(sequence = "GACUCUGUC", comp.sequence = "CUGA-ACAG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.single.bulge.loop = "ser07")
## [1] 31.42849

Long bulge loop effect

The nearest neighbour model for computation in case of sequences with long bulge loop can be specified by the argument method.long.bulge.loop. The available methods are given in Table 13.

Table 13: Details of methods for sequences with long bulge loop

Model Type Limits/Remarks Reference
san04* DNA Missing closing AT penalty. SantaLucia and Hicks (2004)
tur06* RNA Not tested with experimental results. Mathews et al. (1999), Lu et al. (2006)
* Default method for computation.

Examples

    DNA:ATATGACGCCACAGCG
        |||||   ||||||||
    DNA:TATAC---GGTGTCGC

    RNA:AUAUGACGCCACAGCG
        |||||   ||||||||
    RNA:UAUAC---GGUGUCGC
# Long bulge loop effect - default (DNA/DNA)
melting(sequence = "ATATGACGCCACAGCG", comp.sequence = "TATAC---GGTGTCGC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1)
## [1] 51.7104
# Long bulge loop effect - san04 (DNA/DNA)
melting(sequence = "ATATGACGCCACAGCG", comp.sequence = "TATAC---GGTGTCGC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1, method.long.bulge.loop = "san04")
## [1] 51.7104
# Long bulge loop effect - default (RNA/RNA)
melting(sequence = "AUAUGACGCCACAGCG", comp.sequence = "UAUAC---GGUGUCGC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1)
## [1] 66.0497
# Long bulge loop effect -  tur06 (RNA/RNA)
melting(sequence = "AUAUGACGCCACAGCG", comp.sequence = "UAUAC---GGUGUCGC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.long.bulge.loop = "tur06")
## [1] 66.0497

CNG repeats effect

The nearest neighbour model for computation in case of sequences with CNG repeats can be specified by the argument method.CNG. The available methods are given in Table 14.

Table 14: Details of methods for sequences with CNG repeats

Model Type Limits/Remarks Reference
bro05* RNA Self complementary sequences. 2 to 7 CNG repeats. Broda et al. (2005)
* Default method for computation.

Examples

    RNA:GCGGCGGCGGC
        |||||||||||
    RNA:CGCCGCCGCCG
# CNG repeats effect - default (RNA/RNA)
melting(sequence = "GCGGCGGCGGC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1)
## [1] 94.25719
# CNG repeats effect -  bro05 (RNA/RNA)
melting(sequence = "GCGGCGGCGGC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.CNG = "bro05")
## [1] 94.25719

Inosine bases effect

The nearest neighbour model for computation in case of sequences with inosine bases (I) can be specified by the argument method.inosine. The available methods are given in Table 15.

Table 15: Details of methods for sequences with inosine bases

Model Type Limits/Remarks Reference
san05* DNA Missing parameters for tandem base pairs containing inosine bases. Watkins and SantaLucia (2005)
zno07* RNA Only IU base pairs. Wright et al. (2007)
* Default method for computation.

Examples

    DNA:CCGICTGTIGCG
        ||| |||| |||
    DNA:GGCCGACACCGC

    RNA:GCAICGC
        ||| |||
    RNA:CGUUGCG
# Inosine bases effect - default (DNA/DNA)
melting(sequence = "CCGICTGTIGCG", comp.sequence = "GGCCGACACCGC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1)
## [1] 65.36853
# Inosine bases effect - san05 (DNA/DNA)
melting(sequence = "CCGICTGTIGCG", comp.sequence = "GGCCGACACCGC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1, method.inosine = "san05")
## [1] 65.36853
# Inosine bases effect - default (RNA/RNA)
melting(sequence = "GCAICGC", comp.sequence = "CGUUGCG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1)
## [1] 46.75042
# Inosine bases effect -  zno07 (RNA/RNA)
melting(sequence = "GCAICGC", comp.sequence = "CGUUGCG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "rnarna",
        Na.conc = 1, method.inosine = "zno07")
## [1] 46.75042

Hydroxyadenine bases effect

The nearest neighbour model for computation in case of sequences with hydroxyadenine bases can be specified by the argument method.hydroxyadenine. The available methods are given in Table 16.

Table 16: Details of methods for sequences with hydroxyadenine bases

Model Type Limits/Remarks Reference
sug01* DNA Only 5’ GA*C 3’and 5’ TA*A 3’ contexts. Kawakami et al. (2001)
* Default method for computation.

Examples

               *
    DNA:AGAAATGACACGGTG
        |||||||||||||||
    DNA:TCTTTACCGTGCCAC
# Hydroxyadenine bases effect - default (DNA/DNA)
melting(sequence = "AGAAATGA*CACGGTG", comp.sequence = "TCTTTACCGTGCCAC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1)
## [1] 68.46041
# Hydroxyadenine bases effect - sug01 (DNA/DNA)
melting(sequence = "AGAAATGA*CACGGTG", comp.sequence = "TCTTTACCGTGCCAC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1, method.hydroxyadenine = "sug01")
## [1] 68.46041

Azobenzenes effect

The nearest neighbour model for computation in case of sequences with azobenzenes (X_T for trans azobenzenes and X_C for cis azobenzenes) can be specified by the argument method.azobenzenes. The available methods are given in Table 17.

Table 17: Details of methods for sequences with azobenzenes

Model Type Limits/Remarks Reference
asa05* DNA Less reliable results when the number of cis azobenzene increases. Asanuma et al. (2005)
* Default method for computation.

Examples

          C    C    C    C    C
    DNA:CTXTTAAXGAAGXGAGAXTATAXCC
        || |||| |||| |||| |||| ||
    DNA:GA AATT CTTC CTCT ATAT GG
# Azobenzenes effect - default (DNA/DNA)
melting(sequence = "CTX_CTTAAX_CGAAGX_CGAGAX_CTATAX_CCC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1)
## [1] 47.85385
# Azobenzenes effect - asa05 (DNA/DNA)
melting(sequence = "CTX_CTTAAX_CGAAGX_CGAGAX_CTATAX_CCC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1, method.azobenzenes = "asa05")
## [1] 47.85385

Single Locked nucleic acid effect

The nearest neighbour model for computation in case of sequences with single locked nucleic acids can be specified by the argument method.locked. The available methods are given in Table 18.

Table 18: Details of methods for sequences with single locked nucleic acids

Model Type Limits/Remarks Reference
mct04 DNA McTigue et al. (2004)
owc11* DNA Owczarzy et al. (2011)
* Default method for computation.

Examples

             L  
    DNA:CCATTGCTACC
        |||||||||||
    DNA:GGTAACGATGG
# Single locked nucleic acids effect - default (DNA/DNA)
melting(sequence = "CCATTLGCTACC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1)
## [1] 63.48299
# Single locked nucleic acids effect - mct04 (DNA/DNA)
melting(sequence = "CCATTLGCTACC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1, method.locked = "mct04")
## [1] 63.61426
# Single locked nucleic acids effect - owc11 (DNA/DNA)
melting(sequence = "CCATTLGCTACC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1, method.locked = "owc11")
## [1] 63.48299

Consecutive Locked nucleic acids effect

The nearest neighbour model for computation in case of sequences with consecutive locked nucleic acids can be specified by the argument method.consecutive.locked. The available methods are given in Table 19.

Table 19: Details of methods for sequences with single locked nucleic acids

Model Type Limits/Remarks Reference
owc11* DNA Owczarzy et al. (2011)
* Default method for computation.

Examples

          LL  
    DNA:GACC
        ||||
    DNA:CTGG
# Consecutive locked nucleic acids effect - default (DNA/DNA)
melting(sequence = "GALCLC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1)
## [1] 12.94323
# Consecutive locked nucleic acids effect - owc11 (DNA/DNA)
melting(sequence = "GALCLC",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1, method.consecutive.locked = "owc11")
## [1] 12.94323

Consecutive Locked nucleic acids with a single mismatch effect

The nearest neighbour model for computation in case of sequences with consecutive locked nucleic acids with single mismatch can be specified by the argument method.consecutive.locked.singleMM. The available methods are given in Table 20.

Table 20: Details of methods for sequences with single locked nucleic acids

Model Type Limits/Remarks Reference
owc11* DNA Owczarzy et al. (2011)
* Default method for computation.

Examples

          LLL  
    DNA:GACGC
        || ||
    DNA:CTTCG
# Consecutive locked nucleic acids effect - default (DNA/DNA)
melting(sequence = "GALCLGLC", comp.sequence = "CTTCG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1)
## [1] 0.2520424
# Consecutive locked nucleic acids effect - owc11 (DNA/DNA)
melting(sequence = "GALCLGLC", comp.sequence = "CTTCG",
        nucleic.acid.conc = 0.0001, hybridisation.type = "dnadna",
        Na.conc = 1, method.consecutive.locked.singleMM = "owc11")
## [1] 0.2520424

Corrections

Once the melting temperature is computed, a correction is applied to it according to the concentration of nucleic acids, cations and/or denaturing agents.

Nucleic acid concentration

For self complementary sequences (auto detected or specified by force.self) it is 1. Otherwise it is 4 if the both strands are present in equivalent amount and 1 if one strand is in excess.

Ion corrections

Melting temperature is computed initially for \([\textrm{Na}^{+}]\) = 1 M, after which a correction for the presence of cations (\([\textrm{Na}^{+}]\), \([\textrm{K}^{+}]\), \([\textrm{Tris}^{+}]\) and \([\textrm{Mg}^{+}]\)) is applied either directly on the computed melting temperature or on the computed entropy.

Th correction methods for cation concentration can be specified by the argument correction.ion.

Sodium corrections

The available correction methods for sodium concentration are given in Table 21.

Table 21: Details of the corrections for sodium concentration

Correction Type Limits/Remarks Reference
ahs01 DNA Na>0. Ahsen et al. (2001)
kam71 DNA Na>0; Na>=0.069; Na<=1.02. Frank-Kamenetskii (1971)
marschdot DNA Na>=0.069; Na<=1.02. Marmur and Doty (1962), Blake and Delcourt (1998)
owc1904 DNA Na>0. (equation 19) Owczarzy et al. (2004)
owc2004 DNA Na>0. (equation 20) Owczarzy et al. (2004)
owc2104 DNA Na>0. (equation 21) Owczarzy et al. (2004)
owc2204* DNA Na>0. (equation 22) Owczarzy et al. (2004)
san96 DNA Na>=0.1. SantaLucia et al. (1996)
san04 DNA Na>=0.05; Na<=1.1; Oligonucleotides inferior to 16 bases. SantaLucia and Hicks (2004), SantaLucia (1998)
schlif DNA Na>=0.07; Na<=0.12. Schildkraut and Lifson (1965)
tanna06 DNA Na>=0.001; Na<=1. Tan and Chen (2006)
tanna07* RNA or 2’-O-MeRNA/RNA Na>=0.003; Na<=1. Tan and Chen (2007)
wet91 RNA, DNA and RNA/DNA Na>0. Wetmur (1991)
* Default method for computation.
# Na correction - default (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069)
## [1] 56.70492
# Na correction - owc2204 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, correction.ion = "owc2204")
## [1] 56.70492
# Na correction - ahs01 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, correction.ion = "ahs01")
## [1] 54.1569
# Na correction - kam71 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, correction.ion = "kam71")
## [1] 51.72963
# Na correction - marschdot (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, correction.ion = "marschdot")
## [1] 49.18075
# Na correction - owc1904 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, correction.ion = "owc1904")
## [1] 56.18571
# Na correction - owc2004 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, correction.ion = "owc2004")
## [1] 56.67553
# Na correction - owc2104 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, correction.ion = "owc2104")
## [1] 56.63967
# Na correction - san96 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, correction.ion = "san96")
## [1] 53.01651
# Na correction - san04 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, correction.ion = "san04")
## [1] 54.15157
# Na correction - schlif (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, correction.ion = "schlif")
## [1] 48.25579
# Na correction - tanna06 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, correction.ion = "tanna06")
## [1] 55.26711
# Na correction - wet91 (DNA/DNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, correction.ion = "wet91")
## [1] 51.74573
# Na correction - default (RNA/RNA)
melting(sequence = "CCAGCCAGUCUCUCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
        Na.conc = 0.069)
## [1] 75.1552
# Na correction -  tanna07 (RNA/RNA)
melting(sequence = "CCAGCCAGUCUCUCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
        Na.conc = 0.069, correction.ion = "tanna07")
## [1] 75.1552
# Na correction -  wet91 (RNA/RNA)
melting(sequence = "CCAGCCAGUCUCUCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
        Na.conc = 0.069, correction.ion = "wet91")
## [1] 69.55572
# Na correction - default (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
        nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
        Na.conc = 0.069)
## [1] 81.57763
# Na correction -  tanna07 (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
        nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
        Na.conc = 0.069, correction.ion = "tanna07")
## [1] 81.57763
# Na correction - default (DNA/RNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnarna",
        Na.conc = 0.069)
## [1] 62.08869
# Na correction - wet91 (DNA/RNA)
melting(sequence = "CCAGCCAGTCTCTCC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnarna",
        Na.conc = 0.069, correction.ion = "wet91")
## [1] 62.08869

Magnesium corrections

The available correction methods for magnesium concentration are given in Table 22.

Table 22: Details of the corrections for magnesium concentration

Correction Type Limits/Remarks Reference
owcmg08* DNA Mg>=0.0005; Mg<=0.6. Owczarzy et al. (2008)
tanmg06 DNA Mg>=0.0001; Mg<=1; Oligomer length superior to 6 base pairs. Tan and Chen (2006)
tanmg07* RNA or 2’-O-MeRNA/RNA Mg>=0.1; Mg<=0.3. Tan and Chen (2007)
* Default method for computation.
# Mg correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Mg.conc = 0.0015)
## [1] 65.52043
# Mg correction - owcmg08 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Mg.conc = 0.0015, correction.ion = "owcmg08")
## [1] 65.52043
# Mg correction - tanmg06 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Mg.conc = 0.0015, correction.ion = "tanmg06")
## [1] 64.88082
# Mg correction - default (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
        Mg.conc = 0.0015)
## [1] 82.0796
# Mg correction -  tanmg07 (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
        Mg.conc = 0.0015, correction.ion = "tanmg07")
## [1] 82.0796
# Mg correction - default (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
        nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
        Mg.conc = 0.0015)
## [1] 90.06842
# Mg correction -  tanmg07 (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
        nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
        Mg.conc = 0.0015, correction.ion = "tanmg07")
## [1] 90.06842

Mixed Sodium and Magnesium corrections

The available correction methods for mixed sodium magnesium concentration are given in Table 23.

Table 23: Details of the corrections for mixed sodium and magnesium concentration

Correction Type Limits/Remarks Reference
owcmix08* DNA Mg>=0.0005; Mg<=0.6; Na+K+Tris/2>0. Owczarzy et al. (2008)
tanmix07 DNA, RNA or 2’-O-MeRNA/RNA Mg>=0.1; Mg<=0.3; Na+K+Tris/2>=0.1; Na+K+Tris/2<=0.3. Tan and Chen (2007)
* Default method for computation.
# Mixed Na & Mg correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, Mg.conc = 0.0015)
## [1] 65.83371
# Mixed Na & Mg correction - owcmix08 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "owcmix08")
## [1] 65.83371
# Mixed Na & Mg correction - tanmix07 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07")
## [1] 63.21723
# Mixed Na & Mg correction - default (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
        Na.conc = 0.069, Mg.conc = 0.0015)
## [1] 79.40119
# Mixed Na & Mg correction - tanmix07 (RNA/RNA)
melting(sequence = "CAGCCUCGUCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "rnarna",
        Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07")
## [1] 79.40119
# Mixed Na & Mg correction - default (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
        nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
        Na.conc = 0.069, Mg.conc = 0.0015)
## [1] 96.46186
# Mixed Na & Mg correction - tanmix07 (mRNA/RNA)
melting(sequence = "UACGCGUCAAUAACGCUA",
        nucleic.acid.conc = 0.000002, hybridisation.type = "mrnarna",
        Na.conc = 0.069, Mg.conc = 0.0015, correction.ion = "tanmix07")
## [1] 96.46186

The ion correction by Owczarzy et al. (2008) is used by default according to the \(\frac{[\textrm{Mg}^{2+}]^{0.5}}{[\textrm{Mon}^{+}]}\) ratio, where \([\textrm{Mon}^{+}] = \textrm{Na}^{+}]+[\textrm{Tris}^{+}]+[\textrm{K}^{+}]\).

If,

  • \([\textrm{K}^{+}] = 0\), default sodium correction is used;
  • Ratio \(<\) 0.22, default sodium correction is used;
  • 0.22 \(\leq\) Ratio \(<\) 6, default mixed Na and Mg correction is used and
  • Ratio \(\geq\) 6,default magnesium correction is used.

Note that \([\textrm{Tris}^{+}]\) is about half of the total tris buffer concentration.

Sodium equivalent concentration methods

The available correction methods for mixed sodium magnesium concentration are given in Table 24.

Table 24: Details of the methods for computation of sodium equivalent concentration in the presence of other ions

Correction Type Limits/Remarks Reference
ahs01* DNA Ahsen et al. (2001)
mit96 DNA Mitsuhashi (1996)
pey00 DNA Peyret (2000)
* Default method for computation.
# Na equivalent concentration method - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, Mg.conc = 0.0015)
## [1] 65.83371
# Na equivalent concentration method - ahs01 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "ahs01")
## [1] 65.83371
# Na equivalent concentration method - mit96 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "mit96")
## [1] 65.83371
# Na equivalent concentration method - pey00 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 0.069, Mg.conc = 0.0015, method.Naeq = "pey00")
## [1] 65.83371

Denaturing agent corrections

These include melting temperature corrections for concentration of formamide and DMSO.

DMSO corrections

The available correction methods for DMSO concentration are given in Table 25.

Table 25: Details of the corrections for DMSO concentration

Correction Type Limits/Remarks Reference
ahs01* DNA Not tested with experimental results. Ahsen et al. (2001)
cul76 DNA Not tested with experimental results. Cullen and Bick (1976)
esc80 DNA Not tested with experimental results. Escara and Hutton (1980)
mus81 DNA Not tested with experimental results. Musielski et al. (1981)
* Default method for computation.
# DMSO correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 1, DMSO.conc = 10)
## [1] 65.40154
# DMSO correction - ahs01 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 1, DMSO.conc = 10, correction.DMSO = "ahs01")
## [1] 65.40154
# DMSO correction - cul76 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 1, DMSO.conc = 10, correction.DMSO = "cul76")
## [1] 67.90154
# DMSO correction - esc80 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 1, DMSO.conc = 10, correction.DMSO = "esc80")
## [1] 66.15154
# DMSO correction - mus80 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 1, DMSO.conc = 10, correction.DMSO = "mus81")
## [1] 66.90154

Formamide corrections

The available correction methods for formamide concentration are given in Table 26.

Table 26: Details of the corrections for formamide concentration

Correction Type Limits/Remarks Reference
bla96* DNA With formamide concentration in mol/L. Blake (1996)
lincorr DNA With a % of formamide volume. McConaughy et al. (1969), Record (1967), Casey and Davidson (1977), Hutton (1977)
* Default method for computation.
# Formamide correction - default (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 1, formamide.conc = 0.06)
## [1] 72.74867
# Formamide correction - bla96 (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 1, formamide.conc = 0.06, correction.formamide = "bla96")
## [1] 72.74867
# Formamide correction - lincorr (DNA/DNA)
melting(sequence = "CAGCCTCGTCGCAGC",
        nucleic.acid.conc = 0.000002, hybridisation.type = "dnadna",
        Na.conc = 1, formamide.conc = 10, correction.formamide = "lincorr")
## [1] 66.40154

Equivalent options in MELTING 5

The options in MELTING 5 command line equivalent to the arguments in rmelting are given in Table 27.

Table 27: Arguments in rmelting and their equivalent options in MELTING 5 command line.

rmelting MELTING 5 (command line)
sequence -S
comp.sequence -C
nucleic.acid.conc -P
hybridisation.type -H
Na.conc -E
Mg.conc -E
Tris.conc -E
K.conc -E
dNTP.conc -E
DMSO.conc -E
formamide.conc -E
size.threshold -T
self -self
correction.factor -F
method.approx -am
method.nn -nn
method.GU -GU
method.singleMM -sinMM
method.tandemMM -tanMM
method.single.dangle -sinDE
method.double.dangle -secDE
method.long.dangle -lonDE
method.internal.loop -intLP
method.single.bulge.loop -sinBU
method.long.bulge.loop -lonBU
method.CNG -CNG
method.inosine -ino
method.hydroxyadenine -ha
method.azobenzenes -azo
method.locked -lck
method.consecutive.locked -tanLck
method.consecutive.locked.singleMM -sinMMLck
correction.ion -ion
method.Naeq -naeq

Batch computation

Melting temperature for multiple nucleic acid duplexes can be computed using the meltingBatch function.

sequence <- c("CAAAAAG", "CAAAAAAG", "TTTTATAATAAA", "CCATCGCTACC",
              "CAAACAAAG", "CCATTGCTACC", "CAAAAAAAG", "GTGAAC", "AAAAAAAA",
              "CAACTTGATATTATTA", "CAAATAAAG", "GCGAGC", "GGGACC",
              "CAAAGAAAG", "CTGACAAGTGTC", "GCGAAAAGCG")

meltingBatch(sequence, nucleic.acid.conc = 0.0004,
             hybridisation.type = "dnadna", Na.conc = 1)
##       Environment.Sequence Environment.Complementary sequence
##  [1,] "CAAAAAG"            "GTTTTTC"                         
##  [2,] "CAAAAAAG"           "GTTTTTTC"                        
##  [3,] "TTTTATAATAAA"       "AAAATATTATTT"                    
##  [4,] "CCATCGCTACC"        "GGTAGCGATGG"                     
##  [5,] "CAAACAAAG"          "GTTTGTTTC"                       
##  [6,] "CCATTGCTACC"        "GGTAACGATGG"                     
##  [7,] "CAAAAAAAG"          "GTTTTTTTC"                       
##  [8,] "GTGAAC"             "CACTTG"                          
##  [9,] "AAAAAAAA"           "TTTTTTTT"                        
## [10,] "CAACTTGATATTATTA"   "GTTGAACTATAATAAT"                
## [11,] "CAAATAAAG"          "GTTTATTTC"                       
## [12,] "GCGAGC"             "CGCTCG"                          
## [13,] "GGGACC"             "CCCTGG"                          
## [14,] "CAAAGAAAG"          "GTTTCTTTC"                       
## [15,] "CTGACAAGTGTC"       "GACTGTTCACAG"                    
## [16,] "GCGAAAAGCG"         "CGCTTTTCGC"                      
##       Environment.Nucleic acid concentration (M) Environment.Hybridization type
##  [1,] "4e-04"                                    "dnadna"                      
##  [2,] "4e-04"                                    "dnadna"                      
##  [3,] "4e-04"                                    "dnadna"                      
##  [4,] "4e-04"                                    "dnadna"                      
##  [5,] "4e-04"                                    "dnadna"                      
##  [6,] "4e-04"                                    "dnadna"                      
##  [7,] "4e-04"                                    "dnadna"                      
##  [8,] "4e-04"                                    "dnadna"                      
##  [9,] "4e-04"                                    "dnadna"                      
## [10,] "4e-04"                                    "dnadna"                      
## [11,] "4e-04"                                    "dnadna"                      
## [12,] "4e-04"                                    "dnadna"                      
## [13,] "4e-04"                                    "dnadna"                      
## [14,] "4e-04"                                    "dnadna"                      
## [15,] "4e-04"                                    "dnadna"                      
## [16,] "4e-04"                                    "dnadna"                      
##       Environment.Na concentration (M) Environment.Mg concentration (M)
##  [1,] "1"                              "0"                             
##  [2,] "1"                              "0"                             
##  [3,] "1"                              "0"                             
##  [4,] "1"                              "0"                             
##  [5,] "1"                              "0"                             
##  [6,] "1"                              "0"                             
##  [7,] "1"                              "0"                             
##  [8,] "1"                              "0"                             
##  [9,] "1"                              "0"                             
## [10,] "1"                              "0"                             
## [11,] "1"                              "0"                             
## [12,] "1"                              "0"                             
## [13,] "1"                              "0"                             
## [14,] "1"                              "0"                             
## [15,] "1"                              "0"                             
## [16,] "1"                              "0"                             
##       Environment.Tris concentration (M) Environment.K concentration (M)
##  [1,] "0"                                "0"                            
##  [2,] "0"                                "0"                            
##  [3,] "0"                                "0"                            
##  [4,] "0"                                "0"                            
##  [5,] "0"                                "0"                            
##  [6,] "0"                                "0"                            
##  [7,] "0"                                "0"                            
##  [8,] "0"                                "0"                            
##  [9,] "0"                                "0"                            
## [10,] "0"                                "0"                            
## [11,] "0"                                "0"                            
## [12,] "0"                                "0"                            
## [13,] "0"                                "0"                            
## [14,] "0"                                "0"                            
## [15,] "0"                                "0"                            
## [16,] "0"                                "0"                            
##       Environment.dNTP concentration (M) Environment.DMSO concentration (%)
##  [1,] "0"                                "0"                               
##  [2,] "0"                                "0"                               
##  [3,] "0"                                "0"                               
##  [4,] "0"                                "0"                               
##  [5,] "0"                                "0"                               
##  [6,] "0"                                "0"                               
##  [7,] "0"                                "0"                               
##  [8,] "0"                                "0"                               
##  [9,] "0"                                "0"                               
## [10,] "0"                                "0"                               
## [11,] "0"                                "0"                               
## [12,] "0"                                "0"                               
## [13,] "0"                                "0"                               
## [14,] "0"                                "0"                               
## [15,] "0"                                "0"                               
## [16,] "0"                                "0"                               
##       Environment.Formamide concentration (M or %)
##  [1,] "0"                                         
##  [2,] "0"                                         
##  [3,] "0"                                         
##  [4,] "0"                                         
##  [5,] "0"                                         
##  [6,] "0"                                         
##  [7,] "0"                                         
##  [8,] "0"                                         
##  [9,] "0"                                         
## [10,] "0"                                         
## [11,] "0"                                         
## [12,] "0"                                         
## [13,] "0"                                         
## [14,] "0"                                         
## [15,] "0"                                         
## [16,] "0"                                         
##       Environment.Self complementarity Environment.Correction factor
##  [1,] "FALSE"                          "4"                          
##  [2,] "FALSE"                          "4"                          
##  [3,] "FALSE"                          "4"                          
##  [4,] "FALSE"                          "4"                          
##  [5,] "FALSE"                          "4"                          
##  [6,] "FALSE"                          "4"                          
##  [7,] "FALSE"                          "4"                          
##  [8,] "FALSE"                          "4"                          
##  [9,] "FALSE"                          "4"                          
## [10,] "FALSE"                          "4"                          
## [11,] "FALSE"                          "4"                          
## [12,] "FALSE"                          "4"                          
## [13,] "FALSE"                          "4"                          
## [14,] "FALSE"                          "4"                          
## [15,] "FALSE"                          "4"                          
## [16,] "FALSE"                          "4"                          
##       Options.Approximative formula Options.Nearest neighbour model
##  [1,] NA                            NA                             
##  [2,] NA                            NA                             
##  [3,] NA                            NA                             
##  [4,] NA                            NA                             
##  [5,] NA                            NA                             
##  [6,] NA                            NA                             
##  [7,] NA                            NA                             
##  [8,] NA                            NA                             
##  [9,] NA                            NA                             
## [10,] NA                            NA                             
## [11,] NA                            NA                             
## [12,] NA                            NA                             
## [13,] NA                            NA                             
## [14,] NA                            NA                             
## [15,] NA                            NA                             
## [16,] NA                            NA                             
##       Options.GU model Options.Single mismatch model
##  [1,] NA               NA                           
##  [2,] NA               NA                           
##  [3,] NA               NA                           
##  [4,] NA               NA                           
##  [5,] NA               NA                           
##  [6,] NA               NA                           
##  [7,] NA               NA                           
##  [8,] NA               NA                           
##  [9,] NA               NA                           
## [10,] NA               NA                           
## [11,] NA               NA                           
## [12,] NA               NA                           
## [13,] NA               NA                           
## [14,] NA               NA                           
## [15,] NA               NA                           
## [16,] NA               NA                           
##       Options.Tandem mismatch model Options.Single dangling end model
##  [1,] NA                            NA                               
##  [2,] NA                            NA                               
##  [3,] NA                            NA                               
##  [4,] NA                            NA                               
##  [5,] NA                            NA                               
##  [6,] NA                            NA                               
##  [7,] NA                            NA                               
##  [8,] NA                            NA                               
##  [9,] NA                            NA                               
## [10,] NA                            NA                               
## [11,] NA                            NA                               
## [12,] NA                            NA                               
## [13,] NA                            NA                               
## [14,] NA                            NA                               
## [15,] NA                            NA                               
## [16,] NA                            NA                               
##       Options.Double dangling end model Options.Long dangling end model
##  [1,] NA                                NA                             
##  [2,] NA                                NA                             
##  [3,] NA                                NA                             
##  [4,] NA                                NA                             
##  [5,] NA                                NA                             
##  [6,] NA                                NA                             
##  [7,] NA                                NA                             
##  [8,] NA                                NA                             
##  [9,] NA                                NA                             
## [10,] NA                                NA                             
## [11,] NA                                NA                             
## [12,] NA                                NA                             
## [13,] NA                                NA                             
## [14,] NA                                NA                             
## [15,] NA                                NA                             
## [16,] NA                                NA                             
##       Options.Internal loop model Options.Single bulge loop model
##  [1,] NA                          NA                             
##  [2,] NA                          NA                             
##  [3,] NA                          NA                             
##  [4,] NA                          NA                             
##  [5,] NA                          NA                             
##  [6,] NA                          NA                             
##  [7,] NA                          NA                             
##  [8,] NA                          NA                             
##  [9,] NA                          NA                             
## [10,] NA                          NA                             
## [11,] NA                          NA                             
## [12,] NA                          NA                             
## [13,] NA                          NA                             
## [14,] NA                          NA                             
## [15,] NA                          NA                             
## [16,] NA                          NA                             
##       Options.Long bulge loop model Options.CNG repeats model
##  [1,] NA                            NA                       
##  [2,] NA                            NA                       
##  [3,] NA                            NA                       
##  [4,] NA                            NA                       
##  [5,] NA                            NA                       
##  [6,] NA                            NA                       
##  [7,] NA                            NA                       
##  [8,] NA                            NA                       
##  [9,] NA                            NA                       
## [10,] NA                            NA                       
## [11,] NA                            NA                       
## [12,] NA                            NA                       
## [13,] NA                            NA                       
## [14,] NA                            NA                       
## [15,] NA                            NA                       
## [16,] NA                            NA                       
##       Options.Inosine bases model Options.Hydroxyadenine bases model
##  [1,] NA                          NA                                
##  [2,] NA                          NA                                
##  [3,] NA                          NA                                
##  [4,] NA                          NA                                
##  [5,] NA                          NA                                
##  [6,] NA                          NA                                
##  [7,] NA                          NA                                
##  [8,] NA                          NA                                
##  [9,] NA                          NA                                
## [10,] NA                          NA                                
## [11,] NA                          NA                                
## [12,] NA                          NA                                
## [13,] NA                          NA                                
## [14,] NA                          NA                                
## [15,] NA                          NA                                
## [16,] NA                          NA                                
##       Options.Azobenzenes model Options.Locked nucleic acids model
##  [1,] NA                        NA                                
##  [2,] NA                        NA                                
##  [3,] NA                        NA                                
##  [4,] NA                        NA                                
##  [5,] NA                        NA                                
##  [6,] NA                        NA                                
##  [7,] NA                        NA                                
##  [8,] NA                        NA                                
##  [9,] NA                        NA                                
## [10,] NA                        NA                                
## [11,] NA                        NA                                
## [12,] NA                        NA                                
## [13,] NA                        NA                                
## [14,] NA                        NA                                
## [15,] NA                        NA                                
## [16,] NA                        NA                                
##       Options.Ion correction method Options.Na equivalence correction method
##  [1,] NA                            NA                                      
##  [2,] NA                            NA                                      
##  [3,] NA                            NA                                      
##  [4,] NA                            NA                                      
##  [5,] NA                            NA                                      
##  [6,] NA                            NA                                      
##  [7,] NA                            NA                                      
##  [8,] NA                            NA                                      
##  [9,] NA                            NA                                      
## [10,] NA                            NA                                      
## [11,] NA                            NA                                      
## [12,] NA                            NA                                      
## [13,] NA                            NA                                      
## [14,] NA                            NA                                      
## [15,] NA                            NA                                      
## [16,] NA                            NA                                      
##       Options.DMSO correction method Options.Formamide correction method
##  [1,] NA                             NA                                 
##  [2,] NA                             NA                                 
##  [3,] NA                             NA                                 
##  [4,] NA                             NA                                 
##  [5,] NA                             NA                                 
##  [6,] NA                             NA                                 
##  [7,] NA                             NA                                 
##  [8,] NA                             NA                                 
##  [9,] NA                             NA                                 
## [10,] NA                             NA                                 
## [11,] NA                             NA                                 
## [12,] NA                             NA                                 
## [13,] NA                             NA                                 
## [14,] NA                             NA                                 
## [15,] NA                             NA                                 
## [16,] NA                             NA                                 
##       Options.Mode Results.Enthalpy (cal) Results.Entropy (cal)
##  [1,] NA           "-47700"               "-138.1"             
##  [2,] NA           "-55600"               "-160.3"             
##  [3,] NA           "-78800"               "-229.7"             
##  [4,] NA           "-83500"               "-227"               
##  [5,] NA           "-64600"               "-183.2"             
##  [6,] NA           "-81100"               "-222.5"             
##  [7,] NA           "-63500"               "-182.5"             
##  [8,] NA           "-41200"               "-117.5"             
##  [9,] NA           "-50700"               "-147.2"             
## [10,] NA           "-113800"              "-323.6"             
## [11,] NA           "-62100"               "-179.8"             
## [12,] NA           "-46000"               "-124.8"             
## [13,] NA           "-40400"               "-109.9"             
## [14,] NA           "-63700"               "-181.3"             
## [15,] NA           "-90400"               "-249.5"             
## [16,] NA           "-80300"               "-218.6"             
##       Results.Enthalpy (J) Results.Entropy (J) Results.Melting temperature (C)
##  [1,] "-199386"            "-577.258"          "31.7814953255144"             
##  [2,] "-232408"            "-670.054"          "38.1103863719918"             
##  [3,] "-329384"            "-960.146"          "44.5553259145469"             
##  [4,] "-349030"            "-948.86"           "67.2098590318261"             
##  [5,] "-270028"            "-765.776"          "47.400072116762"              
##  [6,] "-338998"            "-930.05"           "63.6040550863501"             
##  [7,] "-265430"            "-762.85"           "43.0400604037136"             
##  [8,] "-172216"            "-491.15"           "30.1735038367475"             
##  [9,] "-211926"            "-615.296"          "33.1415226764116"             
## [10,] "-475684"            "-1352.648"         "59.6680431282422"             
## [11,] "-259578"            "-751.564"          "40.2828264688437"             
## [12,] "-192280"            "-521.664"          "48.2393469411973"             
## [13,] "-168872"            "-459.382"          "41.9123740666287"             
## [14,] "-266266"            "-757.834"          "45.9425910944819"             
## [15,] "-377872"            "-1042.91"          "64.379329012421"              
## [16,] "-335654"            "-913.748"          "65.7707030297917"             
##       Message
##  [1,] NA     
##  [2,] NA     
##  [3,] NA     
##  [4,] NA     
##  [5,] NA     
##  [6,] NA     
##  [7,] NA     
##  [8,] NA     
##  [9,] NA     
## [10,] NA     
## [11,] NA     
## [12,] NA     
## [13,] NA     
## [14,] NA     
## [15,] NA     
## [16,] NA

Complementary sequences are computed by default, but need to be specified in case of mismatches, inosine(s) or hydroxyadenine(s) between the two strands.

seq <- c("GCAUACG", "CAGUAGGUC", "CGCUCGC", "GAGUGGAG", "GACAGGCUG",
         "CAGUACGUC", "GACAUCCUG", "GACCACCUG", "CAGAAUGUC", "GCGUCGC",
         "CGUCCGG", "GACUCUCUG", "CAGCUGGUC", "GACUAGCUG", "CUCUGCUC",
         "GCGUCCG", "GUCCGCG", "CGAUCAC", "GACUACCUG", "GACGAUCUG")

comp.seq <- c("CGUUUGC", "GUCGGCCAG", "GCGUGCG", "CUCUUCUC", "CUGUGCGAC",
              "GUCGGGCAG", "CUGUUGGAC", "CUGGGGGAC", "GUCUGGCAG", "CGCUGCG",
              "GCUGGCC", "CUGAUAGAC", "GUCGUUCAG", "CUGAGCGAC", "GAGUUGAG",
              "CGCUGGC", "CUGGCGC", "GCUUGUG", "CUGAGGGAC", "CUGCCAGAC")

meltingBatch(sequence = seq, comp.seq = comp.seq, nucleic.acid.conc = 0.0004,
             hybridisation.type = "rnarna", Na.conc = 1,
             method.singleMM = "tur06")
##       Environment.Sequence Environment.Complementary sequence
##  [1,] "GCAUACG"            "CGUUUGC"                         
##  [2,] "CAGUAGGUC"          "GUCGGCCAG"                       
##  [3,] "CGCUCGC"            "GCGUGCG"                         
##  [4,] "GAGUGGAG"           "CUCUUCUC"                        
##  [5,] "GACAGGCUG"          "CUGUGCGAC"                       
##  [6,] "CAGUACGUC"          "GUCGGGCAG"                       
##  [7,] "GACAUCCUG"          "CUGUUGGAC"                       
##  [8,] "GACCACCUG"          "CUGGGGGAC"                       
##  [9,] "CAGAAUGUC"          "GUCUGGCAG"                       
## [10,] "GCGUCGC"            "CGCUGCG"                         
## [11,] "CGUCCGG"            "GCUGGCC"                         
## [12,] "GACUCUCUG"          "CUGAUAGAC"                       
## [13,] "CAGCUGGUC"          "GUCGUUCAG"                       
## [14,] "GACUAGCUG"          "CUGAGCGAC"                       
## [15,] "CUCUGCUC"           "GAGUUGAG"                        
## [16,] "GCGUCCG"            "CGCUGGC"                         
## [17,] "GUCCGCG"            "CUGGCGC"                         
## [18,] "CGAUCAC"            "GCUUGUG"                         
## [19,] "GACUACCUG"          "CUGAGGGAC"                       
## [20,] "GACGAUCUG"          "CUGCCAGAC"                       
##       Environment.Nucleic acid concentration (M) Environment.Hybridization type
##  [1,] "4e-04"                                    "rnarna"                      
##  [2,] "4e-04"                                    "rnarna"                      
##  [3,] "4e-04"                                    "rnarna"                      
##  [4,] "4e-04"                                    "rnarna"                      
##  [5,] "4e-04"                                    "rnarna"                      
##  [6,] "4e-04"                                    "rnarna"                      
##  [7,] "4e-04"                                    "rnarna"                      
##  [8,] "4e-04"                                    "rnarna"                      
##  [9,] "4e-04"                                    "rnarna"                      
## [10,] "4e-04"                                    "rnarna"                      
## [11,] "4e-04"                                    "rnarna"                      
## [12,] "4e-04"                                    "rnarna"                      
## [13,] "4e-04"                                    "rnarna"                      
## [14,] "4e-04"                                    "rnarna"                      
## [15,] "4e-04"                                    "rnarna"                      
## [16,] "4e-04"                                    "rnarna"                      
## [17,] "4e-04"                                    "rnarna"                      
## [18,] "4e-04"                                    "rnarna"                      
## [19,] "4e-04"                                    "rnarna"                      
## [20,] "4e-04"                                    "rnarna"                      
##       Environment.Na concentration (M) Environment.Mg concentration (M)
##  [1,] "1"                              "0"                             
##  [2,] "1"                              "0"                             
##  [3,] "1"                              "0"                             
##  [4,] "1"                              "0"                             
##  [5,] "1"                              "0"                             
##  [6,] "1"                              "0"                             
##  [7,] "1"                              "0"                             
##  [8,] "1"                              "0"                             
##  [9,] "1"                              "0"                             
## [10,] "1"                              "0"                             
## [11,] "1"                              "0"                             
## [12,] "1"                              "0"                             
## [13,] "1"                              "0"                             
## [14,] "1"                              "0"                             
## [15,] "1"                              "0"                             
## [16,] "1"                              "0"                             
## [17,] "1"                              "0"                             
## [18,] "1"                              "0"                             
## [19,] "1"                              "0"                             
## [20,] "1"                              "0"                             
##       Environment.Tris concentration (M) Environment.K concentration (M)
##  [1,] "0"                                "0"                            
##  [2,] "0"                                "0"                            
##  [3,] "0"                                "0"                            
##  [4,] "0"                                "0"                            
##  [5,] "0"                                "0"                            
##  [6,] "0"                                "0"                            
##  [7,] "0"                                "0"                            
##  [8,] "0"                                "0"                            
##  [9,] "0"                                "0"                            
## [10,] "0"                                "0"                            
## [11,] "0"                                "0"                            
## [12,] "0"                                "0"                            
## [13,] "0"                                "0"                            
## [14,] "0"                                "0"                            
## [15,] "0"                                "0"                            
## [16,] "0"                                "0"                            
## [17,] "0"                                "0"                            
## [18,] "0"                                "0"                            
## [19,] "0"                                "0"                            
## [20,] "0"                                "0"                            
##       Environment.dNTP concentration (M) Environment.DMSO concentration (%)
##  [1,] "0"                                "0"                               
##  [2,] "0"                                "0"                               
##  [3,] "0"                                "0"                               
##  [4,] "0"                                "0"                               
##  [5,] "0"                                "0"                               
##  [6,] "0"                                "0"                               
##  [7,] "0"                                "0"                               
##  [8,] "0"                                "0"                               
##  [9,] "0"                                "0"                               
## [10,] "0"                                "0"                               
## [11,] "0"                                "0"                               
## [12,] "0"                                "0"                               
## [13,] "0"                                "0"                               
## [14,] "0"                                "0"                               
## [15,] "0"                                "0"                               
## [16,] "0"                                "0"                               
## [17,] "0"                                "0"                               
## [18,] "0"                                "0"                               
## [19,] "0"                                "0"                               
## [20,] "0"                                "0"                               
##       Environment.Formamide concentration (M or %)
##  [1,] "0"                                         
##  [2,] "0"                                         
##  [3,] "0"                                         
##  [4,] "0"                                         
##  [5,] "0"                                         
##  [6,] "0"                                         
##  [7,] "0"                                         
##  [8,] "0"                                         
##  [9,] "0"                                         
## [10,] "0"                                         
## [11,] "0"                                         
## [12,] "0"                                         
## [13,] "0"                                         
## [14,] "0"                                         
## [15,] "0"                                         
## [16,] "0"                                         
## [17,] "0"                                         
## [18,] "0"                                         
## [19,] "0"                                         
## [20,] "0"                                         
##       Environment.Self complementarity Environment.Correction factor
##  [1,] "FALSE"                          "4"                          
##  [2,] "FALSE"                          "4"                          
##  [3,] "FALSE"                          "4"                          
##  [4,] "FALSE"                          "4"                          
##  [5,] "FALSE"                          "4"                          
##  [6,] "FALSE"                          "4"                          
##  [7,] "FALSE"                          "4"                          
##  [8,] "FALSE"                          "4"                          
##  [9,] "FALSE"                          "4"                          
## [10,] "FALSE"                          "4"                          
## [11,] "FALSE"                          "4"                          
## [12,] "FALSE"                          "4"                          
## [13,] "FALSE"                          "4"                          
## [14,] "FALSE"                          "4"                          
## [15,] "FALSE"                          "4"                          
## [16,] "FALSE"                          "4"                          
## [17,] "FALSE"                          "4"                          
## [18,] "FALSE"                          "4"                          
## [19,] "FALSE"                          "4"                          
## [20,] "FALSE"                          "4"                          
##       Options.Approximative formula Options.Nearest neighbour model
##  [1,] NA                            NA                             
##  [2,] NA                            NA                             
##  [3,] NA                            NA                             
##  [4,] NA                            NA                             
##  [5,] NA                            NA                             
##  [6,] NA                            NA                             
##  [7,] NA                            NA                             
##  [8,] NA                            NA                             
##  [9,] NA                            NA                             
## [10,] NA                            NA                             
## [11,] NA                            NA                             
## [12,] NA                            NA                             
## [13,] NA                            NA                             
## [14,] NA                            NA                             
## [15,] NA                            NA                             
## [16,] NA                            NA                             
## [17,] NA                            NA                             
## [18,] NA                            NA                             
## [19,] NA                            NA                             
## [20,] NA                            NA                             
##       Options.GU model Options.Single mismatch model
##  [1,] NA               NA                           
##  [2,] NA               NA                           
##  [3,] NA               NA                           
##  [4,] NA               NA                           
##  [5,] NA               NA                           
##  [6,] NA               NA                           
##  [7,] NA               NA                           
##  [8,] NA               NA                           
##  [9,] NA               NA                           
## [10,] NA               NA                           
## [11,] NA               NA                           
## [12,] NA               NA                           
## [13,] NA               NA                           
## [14,] NA               NA                           
## [15,] NA               NA                           
## [16,] NA               NA                           
## [17,] NA               NA                           
## [18,] NA               NA                           
## [19,] NA               NA                           
## [20,] NA               NA                           
##       Options.Tandem mismatch model Options.Single dangling end model
##  [1,] NA                            NA                               
##  [2,] NA                            NA                               
##  [3,] NA                            NA                               
##  [4,] NA                            NA                               
##  [5,] NA                            NA                               
##  [6,] NA                            NA                               
##  [7,] NA                            NA                               
##  [8,] NA                            NA                               
##  [9,] NA                            NA                               
## [10,] NA                            NA                               
## [11,] NA                            NA                               
## [12,] NA                            NA                               
## [13,] NA                            NA                               
## [14,] NA                            NA                               
## [15,] NA                            NA                               
## [16,] NA                            NA                               
## [17,] NA                            NA                               
## [18,] NA                            NA                               
## [19,] NA                            NA                               
## [20,] NA                            NA                               
##       Options.Double dangling end model Options.Long dangling end model
##  [1,] NA                                NA                             
##  [2,] NA                                NA                             
##  [3,] NA                                NA                             
##  [4,] NA                                NA                             
##  [5,] NA                                NA                             
##  [6,] NA                                NA                             
##  [7,] NA                                NA                             
##  [8,] NA                                NA                             
##  [9,] NA                                NA                             
## [10,] NA                                NA                             
## [11,] NA                                NA                             
## [12,] NA                                NA                             
## [13,] NA                                NA                             
## [14,] NA                                NA                             
## [15,] NA                                NA                             
## [16,] NA                                NA                             
## [17,] NA                                NA                             
## [18,] NA                                NA                             
## [19,] NA                                NA                             
## [20,] NA                                NA                             
##       Options.Internal loop model Options.Single bulge loop model
##  [1,] NA                          NA                             
##  [2,] NA                          NA                             
##  [3,] NA                          NA                             
##  [4,] NA                          NA                             
##  [5,] NA                          NA                             
##  [6,] NA                          NA                             
##  [7,] NA                          NA                             
##  [8,] NA                          NA                             
##  [9,] NA                          NA                             
## [10,] NA                          NA                             
## [11,] NA                          NA                             
## [12,] NA                          NA                             
## [13,] NA                          NA                             
## [14,] NA                          NA                             
## [15,] NA                          NA                             
## [16,] NA                          NA                             
## [17,] NA                          NA                             
## [18,] NA                          NA                             
## [19,] NA                          NA                             
## [20,] NA                          NA                             
##       Options.Long bulge loop model Options.CNG repeats model
##  [1,] NA                            NA                       
##  [2,] NA                            NA                       
##  [3,] NA                            NA                       
##  [4,] NA                            NA                       
##  [5,] NA                            NA                       
##  [6,] NA                            NA                       
##  [7,] NA                            NA                       
##  [8,] NA                            NA                       
##  [9,] NA                            NA                       
## [10,] NA                            NA                       
## [11,] NA                            NA                       
## [12,] NA                            NA                       
## [13,] NA                            NA                       
## [14,] NA                            NA                       
## [15,] NA                            NA                       
## [16,] NA                            NA                       
## [17,] NA                            NA                       
## [18,] NA                            NA                       
## [19,] NA                            NA                       
## [20,] NA                            NA                       
##       Options.Inosine bases model Options.Hydroxyadenine bases model
##  [1,] NA                          NA                                
##  [2,] NA                          NA                                
##  [3,] NA                          NA                                
##  [4,] NA                          NA                                
##  [5,] NA                          NA                                
##  [6,] NA                          NA                                
##  [7,] NA                          NA                                
##  [8,] NA                          NA                                
##  [9,] NA                          NA                                
## [10,] NA                          NA                                
## [11,] NA                          NA                                
## [12,] NA                          NA                                
## [13,] NA                          NA                                
## [14,] NA                          NA                                
## [15,] NA                          NA                                
## [16,] NA                          NA                                
## [17,] NA                          NA                                
## [18,] NA                          NA                                
## [19,] NA                          NA                                
## [20,] NA                          NA                                
##       Options.Azobenzenes model Options.Locked nucleic acids model
##  [1,] NA                        NA                                
##  [2,] NA                        NA                                
##  [3,] NA                        NA                                
##  [4,] NA                        NA                                
##  [5,] NA                        NA                                
##  [6,] NA                        NA                                
##  [7,] NA                        NA                                
##  [8,] NA                        NA                                
##  [9,] NA                        NA                                
## [10,] NA                        NA                                
## [11,] NA                        NA                                
## [12,] NA                        NA                                
## [13,] NA                        NA                                
## [14,] NA                        NA                                
## [15,] NA                        NA                                
## [16,] NA                        NA                                
## [17,] NA                        NA                                
## [18,] NA                        NA                                
## [19,] NA                        NA                                
## [20,] NA                        NA                                
##       Options.Ion correction method Options.Na equivalence correction method
##  [1,] NA                            NA                                      
##  [2,] NA                            NA                                      
##  [3,] NA                            NA                                      
##  [4,] NA                            NA                                      
##  [5,] NA                            NA                                      
##  [6,] NA                            NA                                      
##  [7,] NA                            NA                                      
##  [8,] NA                            NA                                      
##  [9,] NA                            NA                                      
## [10,] NA                            NA                                      
## [11,] NA                            NA                                      
## [12,] NA                            NA                                      
## [13,] NA                            NA                                      
## [14,] NA                            NA                                      
## [15,] NA                            NA                                      
## [16,] NA                            NA                                      
## [17,] NA                            NA                                      
## [18,] NA                            NA                                      
## [19,] NA                            NA                                      
## [20,] NA                            NA                                      
##       Options.DMSO correction method Options.Formamide correction method
##  [1,] NA                             NA                                 
##  [2,] NA                             NA                                 
##  [3,] NA                             NA                                 
##  [4,] NA                             NA                                 
##  [5,] NA                             NA                                 
##  [6,] NA                             NA                                 
##  [7,] NA                             NA                                 
##  [8,] NA                             NA                                 
##  [9,] NA                             NA                                 
## [10,] NA                             NA                                 
## [11,] NA                             NA                                 
## [12,] NA                             NA                                 
## [13,] NA                             NA                                 
## [14,] NA                             NA                                 
## [15,] NA                             NA                                 
## [16,] NA                             NA                                 
## [17,] NA                             NA                                 
## [18,] NA                             NA                                 
## [19,] NA                             NA                                 
## [20,] NA                             NA                                 
##       Options.Mode Results.Enthalpy (cal) Results.Entropy (cal)
##  [1,] NA           "-47650"               "-138.8"             
##  [2,] NA           "-71130"               "-200.5"             
##  [3,] NA           "-57930"               "-164.1"             
##  [4,] NA           "-60570"               "-176.6"             
##  [5,] NA           "-79870"               "-219.9"             
##  [6,] NA           "-68380"               "-194.5"             
##  [7,] NA           "-73880"               "-208.3"             
##  [8,] NA           "-78430"               "-218.3"             
##  [9,] NA           "-59650"               "-171.5"             
## [10,] NA           "-61330"               "-173.8"             
## [11,] NA           "-58350"               "-165.4"             
## [12,] NA           "-64570"               "-184.7"             
## [13,] NA           "-70970"               "-200.6"             
## [14,] NA           "-72010"               "-203"               
## [15,] NA           "-58820"               "-171"               
## [16,] NA           "-59840"               "-169.6"             
## [17,] NA           "-59840"               "-169.6"             
## [18,] NA           "-50210"               "-148.3"             
## [19,] NA           "-70520"               "-198.8"             
## [20,] NA           "-69730"               "-198.2"             
##       Results.Enthalpy (J) Results.Entropy (J) Results.Melting temperature (C)
##  [1,] "-199177"            "-580.184"          "30.1048299398322"             
##  [2,] "-297323.4"          "-838.09"           "51.8989532242754"             
##  [3,] "-242147.4"          "-685.938"          "44.3989325444856"             
##  [4,] "-253182.6"          "-738.188"          "37.5791954133529"             
##  [5,] "-333856.6"          "-919.182"          "62.1162425798375"             
##  [6,] "-285828.4"          "-813.01"           "48.141439592185"              
##  [7,] "-308818.4"          "-870.694"          "52.845957204839"              
##  [8,] "-327837.4"          "-912.494"          "58.2977096620104"             
##  [9,] "-249337"            "-716.87"           "41.08087522322"               
## [10,] "-256359.4"          "-726.484"          "46.0633145887674"             
## [11,] "-243903"            "-691.372"          "44.4380466975271"             
## [12,] "-269902.6"          "-772.046"          "44.8840464672343"             
## [13,] "-296654.6"          "-838.508"          "51.0196486690585"             
## [14,] "-301001.8"          "-848.54"           "52.203376709706"              
## [15,] "-245867.6"          "-714.78"           "37.5268181873443"             
## [16,] "-250131.2"          "-708.928"          "45.2688421309843"             
## [17,] "-250131.2"          "-708.928"          "45.2688421309843"             
## [18,] "-209877.8"          "-619.894"          "28.1788644808993"             
## [19,] "-294773.6"          "-830.984"          "51.6345164549562"             
## [20,] "-291471.4"          "-828.476"          "48.8860141674642"             
##       Message
##  [1,] NA     
##  [2,] NA     
##  [3,] NA     
##  [4,] NA     
##  [5,] NA     
##  [6,] NA     
##  [7,] NA     
##  [8,] NA     
##  [9,] NA     
## [10,] NA     
## [11,] NA     
## [12,] NA     
## [13,] NA     
## [14,] NA     
## [15,] NA     
## [16,] NA     
## [17,] NA     
## [18,] NA     
## [19,] NA     
## [20,] NA

Further reading

Further details about algorithm, formulae and methods are available in the MELTING 5 documentation.

Citing rmelting

## To cite the R package 'rmelting' in publications use:
## 
##   Aravind, J. and Krishna, G. K. (2026).  rmelting: R Interface to
##   MELTING 5. R package version 1.29.0,
##   https://aravind-j.github.io/rmelting/.
## 
## A BibTeX entry for LaTeX users is
## 
##   @Manual{,
##     title = {rmelting: R Interface to MELTING 5},
##     author = {J. Aravind and G. K. Krishna},
##     year = {2026},
##     note = {R package version 1.29.0 https://aravind-j.github.io/rmelting/},
##   }
## 
## This free and open-source software implements academic research by the
## authors and co-workers. If you use it, please support the project by
## citing the package.

Session Info

sessionInfo()
## R version 4.6.0 (2026-04-24)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 24.04.4 LTS
## 
## Matrix products: default
## BLAS:   /usr/lib/x86_64-linux-gnu/openblas-pthread/libblas.so.3 
## LAPACK: /usr/lib/x86_64-linux-gnu/openblas-pthread/libopenblasp-r0.3.26.so;  LAPACK version 3.12.0
## 
## locale:
##  [1] LC_CTYPE=en_US.UTF-8          LC_NUMERIC=C                 
##  [3] LC_TIME=en_US.UTF-8           LC_COLLATE=en_US.UTF-8       
##  [5] LC_MONETARY=en_US.UTF-8       LC_MESSAGES=en_US.UTF-8      
##  [7] LC_PAPER=en_US.UTF-8          LC_NAME=en_US.UTF-8          
##  [9] LC_ADDRESS=en_US.UTF-8        LC_TELEPHONE=en_US.UTF-8     
## [11] LC_MEASUREMENT=en_US.UTF-8    LC_IDENTIFICATION=en_US.UTF-8
## 
## time zone: Etc/UTC
## tzcode source: system (glibc)
## 
## attached base packages:
## [1] stats     graphics  grDevices utils     datasets  methods   base     
## 
## other attached packages:
## [1] rmelting_1.29.0 readxl_1.4.5   
## 
## loaded via a namespace (and not attached):
##  [1] vctrs_0.7.3      cli_3.6.6        knitr_1.51       rlang_1.2.0     
##  [5] xfun_0.57        jsonlite_2.0.0   rJava_1.0-18     glue_1.8.1      
##  [9] buildtools_1.0.0 htmltools_0.5.9  maketools_1.3.2  sys_3.4.3       
## [13] sass_0.4.10      rmarkdown_2.31   pander_0.6.6     cellranger_1.1.0
## [17] evaluate_1.0.5   jquerylib_0.1.4  tibble_3.3.1     fastmap_1.2.0   
## [21] yaml_2.3.12      lifecycle_1.0.5  compiler_4.6.0   Rcpp_1.1.1-1.1  
## [25] pkgconfig_2.0.3  digest_0.6.39    R6_2.6.1         pillar_1.11.1   
## [29] Rdpack_2.6.6     rbibutils_2.4.1  magrittr_2.0.5   bslib_0.10.0    
## [33] tools_4.6.0      cachem_1.1.0

References

Ahsen, N. von, Wittwer, C. T., and Schütz, E. (2001). Oligonucleotide melting temperatures under PCR conditions: Nearest-neighbor corrections for Mg2+, deoxynucleotide triphosphate, and dimethyl sulfoxide concentrations with comparison to alternative empirical formulas. Clinical Chemistry 47, 1956–1961. Available at: http://clinchem.aaccjnls.org/content/47/11/1956.
Allawi, H. T., and SantaLucia, J. (1997). Thermodynamics and NMR of internal G·T mismatches in dna. Biochemistry 36, 10581–10594. doi:10.1021/bi962590c.
Allawi, H. T., and SantaLucia, J. (1998a). Nearest neighbor thermodynamic parameters for internal G·A mismatches in DNA. Biochemistry 37, 2170–2179. doi:10.1021/bi9724873.
Allawi, H. T., and SantaLucia, J. (1998b). Nearest-neighbor thermodynamics of internal A·C mismatches in dna: Sequence dependence and pH effects. Biochemistry 37, 9435–9444. doi:10.1021/bi9803729.
Allawi, H. T., and SantaLucia, J. (1998c). Thermodynamics of internal C·T mismatches in DNA. Nucleic Acids Research 26, 2694–2701. doi:10.1093/nar/26.11.2694.
Asanuma, H., Matsunaga, D., and Komiyama, M. (2005). Clear-cut photo-regulation of the formation and dissociation of the DNA duplex by modified oligonucleotide involving multiple azobenzenes. Nucleic Acids Symposium Series, 35–36. doi:10.1093/nass/49.1.35.
Badhwar, J., Karri, S., Cass, C. K., Wunderlich, E. L., and Znosko, B. M. (2007). Thermodynamic characterization of RNA duplexes containing naturally occurring 1 × 2 nucleotide internal loops. Biochemistry 46, 14715–14724. doi:10.1021/bi701024w.
Blake, R. D. (1996). “Denaturation of DNA,” in Encyclopedia of molecular biology and molecular medicine, ed. R. A. Meyers (Weinheim, Germany: VCH Verlagsgesellschaft), 1–19.
Blake, R. D., and Delcourt, S. G. (1998). Thermal stability of DNA. Nucleic Acids Research 26, 3323–3332. doi:10.1093/nar/26.14.3323.
Blose, J. M., Manni, M. L., Klapec, K. A., Stranger-Jones, Y., Zyra, A. C., Sim, V., et al. (2007). Non-nearest-neighbor dependence of stability for RNA bulge loops based on the complete set of group i single nucleotide bulge loops. Biochemistry 46, 15123–15135. doi:10.1021/bi700736f.
Bommarito, S., Peyret, N., and SantaLucia, J. (2000). Thermodynamic parameters for DNA sequences with dangling ends. Nucleic Acids Research 28, 1929–1934. doi:10.1093/nar/28.9.1929.
Breslauer, K. J., Frank, R., Blöcker, H., and Marky, L. A. (1986). Predicting DNA duplex stability from the base sequence. Proceedings of the National Academy of Sciences 83, 3746. doi:10.1073/pnas.83.11.3746.
Britten, R. J., Graham, D. E., and Neufeld, B. R. (1974). Analysis of repeating DNA sequences by reassociation. Methods in Enzymology 29, 363–418. doi:10.1016/0076-6879(74)29033-5.
Broda, M., Kierzek, E., Gdaniec, Z., Kulinski, T., and Kierzek, R. (2005). Thermodynamic stability of RNA structures formed by CNG trinucleotide repeats. Implication for prediction of RNA structure. Biochemistry 44, 10873–10882. doi:10.1021/bi0502339.
Casey, J., and Davidson, N. (1977). Rates of formation and thermal stabilities of RNA:DNA and DNA:DNA duplexes at high concentrations of formamide. Nucleic Acids Research 4, 1539–1552. doi:10.1093/nar/4.5.1539.
Chen, J. L., Dishler, A. L., Kennedy, S. D., Yildirim, I., Liu, B., Turner, D. H., et al. (2012). Testing the nearest neighbor model for canonical rna base pairs: Revision of GU parameters. Biochemistry 51, 3508–3522. doi:10.1021/bi3002709.
Chester, N., and Marshak, D. R. (1993). Dimethyl sulfoxide-mediated primer Tm reduction: A method for analyzing the role of renaturation temperature in the polymerase chain reaction. Analytical Biochemistry 209, 284–290. doi:10.1006/abio.1993.1121.
Cullen, B. R., and Bick, M. D. (1976). Thermal denaturation of DNA from bromodeoxyuridine substituted cells. Nucleic Acids Research 3, 49–62. doi:10.1093/nar/3.1.49.
Davis, A. R., and Znosko, B. M. (2007). Thermodynamic characterization of single mismatches found in naturally occurring RNA. Biochemistry 46, 13425–13436. doi:10.1021/bi701311c.
Davis, A. R., and Znosko, B. M. (2008). Thermodynamic characterization of naturally occurring RNA single mismatches with G-U nearest neighbors. Biochemistry 47, 10178–10187. doi:10.1021/bi800471z.
Dumousseau, M., Rodriguez, N., Juty, N., and Le Novère, N. (2012). MELTING, a flexible platform to predict the melting temperatures of nucleic acids. BMC Bioinformatics 13, 101. doi:10.1186/1471-2105-13-101.
Escara, J. F., and Hutton, J. R. (1980). Thermal stability and renaturation of DNA in dimethyl sulfoxide solutions: Acceleration of the renaturation rate. Biopolymers 19, 1315–1327. doi:10.1002/bip.1980.360190708.
Frank-Kamenetskii, M. D. (1971). Simplification of the empirical relationship between melting temperature of DNA, its GC content and concentration of sodium ions in solution. Biopolymers 10, 2623–2624. doi:10.1002/bip.360101223.
Freier, S. M., Kierzek, R., Jaeger, J. A., Sugimoto, N., Caruthers, M. H., Neilson, T., et al. (1986). Improved free-energy parameters for predictions of RNA duplex stability. Proceedings of the National Academy of Sciences 83, 9373. doi:10.1073/pnas.83.24.9373.
Hall, T. J., Grula, J. W., Davidson, E. H., and Britten, R. J. (1980). Evolution of sea urchin non-repetitive DNA. Journal of Molecular Evolution 16, 95–110. doi:10.1007/BF01731580.
Hutton, J. R. (1977). Renaturation kinetics and thermal stability of DNA in aqueous solutions of formamide and urea. Nucleic Acids Research 4, 3537–3555. doi:10.1093/nar/4.10.3537.
Kawakami, J., Kamiya, H., Yasuda, K., Fujiki, H., Kasai, H., and Sugimoto, N. (2001). Thermodynamic stability of base pairs between 2-hydroxyadenine and incoming nucleotides as a determinant of nucleotide incorporation specificity during replication. Nucleic Acids Research 29, 3289–3296. doi:10.1093/nar/29.16.3289.
Kierzek, E., Mathews, D. H., Ciesielska, A., Turner, D. H., and Kierzek, R. (2006). Nearest neighbor parameters for Watson-Crick complementary heteroduplexes formed between 2’-O-methyl RNA and RNA oligonucleotides. Nucleic Acids Research 34, 3609–3614. doi:10.1093/nar/gkl232.
Le Novère, N. (2001). MELTING, computing the melting temperature of nucleic acid duplex. Bioinformatics 17, 1226–1227. doi:10.1093/bioinformatics/17.12.1226.
Lu, Z. J., Turner, D. H., and Mathews, D. H. (2006). A set of nearest neighbor parameters for predicting the enthalpy change of RNA secondary structure formation. Nucleic Acids Research 34, 4912–4924. doi:10.1093/nar/gkl472.
Marmur, J., and Doty, P. (1962). Determination of the base composition of deoxyribonucleic acid from its thermal denaturation temperature. Journal of Molecular Biology 5, 109–118. doi:10.1016/S0022-2836(62)80066-7.
Mathews, D. H., Sabina, J., Zuker, M., and Turner, D. H. (1999). Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. Journal of Molecular Biology 288, 911–940. doi:10.1006/jmbi.1999.2700.
McConaughy, B. L., Laird, Cd., and McCarthy, B. J. (1969). Nucleic acid reassociation in formamide. Biochemistry 8, 3289–3295. doi:10.1021/bi00836a024.
McTigue, P. M., Peterson, R. J., and Kahn, J. D. (2004). Sequence-dependent thermodynamic parameters for locked nucleic acid (LNA)-DNA duplex formation. Biochemistry 43, 5388–5405. doi:10.1021/bi035976d.
Miller, S., Jones, L. E., Giovannitti, K., Piper, D., and Serra, M. J. (2008). Thermodynamic analysis of 5’ and 3’ single- and 3’ double-nucleotide overhangs neighboring wobble terminal base pairs. Nucleic Acids Research 36, 5652–5659. doi:10.1093/nar/gkn525.
Mitsuhashi, M. (1996). Technical report: Part 1. Basic requirements for designing optimal oligonucleotide probe sequences. Journal of Clinical Laboratory Analysis 10, 277–284. doi:10/cw9bn6.
Musielski, H., Mann, W., Laue, R., and Michel, S. (1981). Influence of dimethylsulfoxide on transcription by bacteriophage T3-induced RNA polymerase. Zeitschrift für allgemeine Mikrobiologie 21, 447–456. doi:10.1002/jobm.19810210606.
O’Toole, A. S., Miller, S., Haines, N., Zink, M. C., and Serra, M. J. (2006). Comprehensive thermodynamic analysis of 3’ double-nucleotide overhangs neighboring Watson-Crick terminal base pairs. Nucleic Acids Research 34, 3338–3344. doi:10.1093/nar/gkl428.
O’Toole, A. S., Miller, S., and Serra, M. J. (2005). Stability of 3’ double nucleotide overhangs that model the 3’ ends of siRNA. RNA 11, 512–516. doi:10.1261/rna.7254905.
Ohmichi, T., Nakano, S., Miyoshi, D., and Sugimoto, N. (2002). Long RNA dangling end has large energetic contribution to duplex stability. Journal of the American Chemical Society 124, 10367–10372. doi:10.1021/ja0255406.
Owczarzy, R., Moreira, B. G., You, Y., Behlke, M. A., and Walder, J. A. (2008). Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations. Biochemistry 47, 5336–5353. doi:10.1021/bi702363u.
Owczarzy, R., You, Y., Groth, C. L., and Tataurov, A. V. (2011). Stability and mismatch discrimination of locked nucleic acid–DNA duplexes. Biochemistry 50, 9352–9367. doi:10.1021/bi200904e.
Owczarzy, R., You, Y., Moreira, B. G., Manthey, J. A., Huang, L., Behlke, M. A., et al. (2004). Effects of sodium ions on DNA duplex oligomers: Improved predictions of melting temperatures. Biochemistry 43, 3537–3554. doi:10.1021/bi034621r.
Owen, R., Hill, L., and Lapage, S. (1969). Determination of DNA base compositions from melting profiles in dilute buffers. Biopolymers 7, 503–516. doi:10.1002/bip.1969.360070408.
Peyret, N. (2000). Prediction of nucleic acid hybridization: Parameters and algorithms. Available at: http://elibrary.wayne.edu/record=2760965.
Peyret, N., Seneviratne, P. A., Allawi, H. T., and SantaLucia, J. (1999). Nearest-Neighbor Thermodynamics and NMR of DNA Sequences with Internal A·A, C·C, G·G, and T·T Mismatches. Biochemistry 38, 3468–3477. doi:10.1021/bi9825091.
Record, M. T. (1967). Electrostatic effects on polynucleotide transitions. I. Behavior at neutral pH. Biopolymers 5, 975–992. doi:10.1002/bip.1967.360051010.
SantaLucia, J. (1998). A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proceedings of the National Academy of Sciences 95, 1460. doi:10.1073/pnas.95.4.1460.
SantaLucia, J., and Hicks, D. (2004). The thermodynamics of DNA structural motifs. Annual Review of Biophysics and Biomolecular Structure 33, 415–440. doi:10.1146/annurev.biophys.32.110601.141800.
SantaLucia, John, Allawi, H. T., and Seneviratne, P. A. (1996). Improved nearest-neighbor parameters for predicting DNA duplex stability. Biochemistry 35, 3555–3562. doi:10.1021/bi951907q.
Schildkraut, C., and Lifson, S. (1965). Dependence of the melting temperature of DNA on salt concentration. Biopolymers 3, 195–208. doi:10.1002/bip.360030207.
Sugimoto, N., Nakano, S., Yoneyama, M., and Honda, K. (1996). Improved thermodynamic parameters and helix initiation factor to predict stability of DNA duplexes. Nucleic Acids Research 24, 4501–4505. doi:10.1093/nar/24.22.4501.
Tan, Z.-J., and Chen, S.-J. (2006). Nucleic acid helix stability: Effects of salt concentration, cation valence and size, and chain length. Biophysical Journal 90, 1175–1190. doi:10.1529/biophysj.105.070904.
Tan, Z.-J., and Chen, S.-J. (2007). RNA helix stability in mixed Na(+)/Mg(2+) solution. Biophysical Journal 92, 3615–3632. doi:10.1529/biophysj.106.100388.
Tanaka, F., Kameda, A., Yamamoto, M., and Ohuchi, A. (2004). Thermodynamic parameters based on a nearest-neighbor model for DNA sequences with a single-bulge loop. Biochemistry 43, 7143–7150. doi:10.1021/bi036188r.
Wahl, G. M., Barger, S. L., and Kimmel, A. R. (1987). Molecular hybridization of immobilized nucleic acids: Theoretical concepts and practical considerations. Methods in Enzymology 152, 399–407. doi:10.1016/0076-6879(87)52046-8.
Watkins, N. E., Kennelly, W. J., Tsay, M. J., Tuin, A., Swenson, L., Lee, H.-R., et al. (2011). Thermodynamic contributions of single internal rA·dA, rC·dC, rG·dG and rU·dT mismatches in RNA/DNA duplexes. Nucleic Acids Research 39, 1894–1902. doi:10/cdm4jh.
Watkins, N. E., and SantaLucia, J. (2005). Nearest-neighbor thermodynamics of deoxyinosine pairs in DNA duplexes. Nucleic Acids Research 33, 6258–6267. doi:10.1093/nar/gki918.
Wetmur, J. G. (1991). DNA probes: Applications of the principles of nucleic acid hybridization. Critical Reviews in Biochemistry and Molecular Biology 26, 227–259. doi:10.3109/10409239109114069.
Wright, D. J., Rice, J. L., Yanker, D. M., and Znosko, B. M. (2007). Nearest neighbor parameters for inosine·uridine pairs in RNA duplexes. Biochemistry 46, 4625–4634. doi:10.1021/bi0616910.
Xia, T., SantaLucia, J., Burkard, M. E., Kierzek, R., Schroeder, S. J., Jiao, X., et al. (1998). Thermodynamic parameters for an expanded nearest-neighbor model for formation of RNA duplexes with Watson-Crick base pairs. Biochemistry 37, 14719–14735. doi:10.1021/bi9809425.