Contents

1 KdModels

The KdModel class contains the information concerning the sequence (12-mer) affinity of a given miRNA, and is meant to compress and make easily manipulable the dissociation constants (Kd) predictions from McGeary, Lin et al. (2019). We can take a look at the example KdModel:

library(scanMiR)
data(SampleKdModel)
SampleKdModel
## A `KdModel` for hsa-miR-155-5p (Conserved across mammals)
##   Sequence: UUAAUGCUAAUCGUGAUAGGGGUU
##   Canonical target seed: AGCATTA(A)

In addition to the information necessary to predict the binding affinity to any given 12-mer sequence, the model contains, minimally, the name and sequence of the miRNA. Since the KdModel class extends the list class, any further information can be stored:

SampleKdModel$myVariable <- "test"

An overview of the binding affinities can be obtained with the following plot:

plotKdModel(SampleKdModel, what="seeds")

The plot gives the -log(Kd) values of the top 7-mers (including both canonical and non-canonical sites), with or without the final “A” vis-à-vis the first miRNA nucleotide.

To predict the dissociation constant (and binding type, if any) of a given 12-mer sequence, you can use the assignKdType function:

assignKdType("ACGTACGTACGT", SampleKdModel)
##            type log_kd
## 1 non-canonical      0
# or using multiple sequences:
assignKdType(c("CTAGCATTAAGT","ACGTACGTACGT"), SampleKdModel)
##            type log_kd
## 1          8mer  -5129
## 2 non-canonical      0

The log_kd column contains log(Kd) values multiplied by 1000 and stored as an integer (which is more economical when dealing with millions of sites). In the example above, -5129 means -5.129, or a dissociation constant of 0.0059225. The smaller the values, the stronger the relative affinity.

1.1 KdModelLists

A KdModelList object is simply a collection of KdModel objects. We can build one in the following way:

# we create a copy of the KdModel, and give it a different name:
mod2 <- SampleKdModel
mod2$name <- "dummy-miRNA"
kml <- KdModelList(SampleKdModel, mod2)
kml
## An object of class "KdModelList"
## [[1]]
## A `KdModel` for hsa-miR-155-5p (Conserved across mammals)
##   Sequence: UUAAUGCUAAUCGUGAUAGGGGUU
##   Canonical target seed: AGCATTA(A)
## [[2]]
## A `KdModel` for dummy-miRNA (Conserved across mammals)
##   Sequence: UUAAUGCUAAUCGUGAUAGGGGUU
##   Canonical target seed: AGCATTA(A)
summary(kml)
## A `KdModelList` object containing binding affinity models from 2 miRNAs.
## 
##               Low-confidence             Poorly conserved 
##                            0                            0 
##     Conserved across mammals Conserved across vertebrates 
##                            2                            0

Beyond operations typically performed on a list (e.g. subsetting), some specific slots of the respective KdModels can be accessed, for example:

conservation(kml)
##           hsa-miR-155-5p              dummy-miRNA 
## Conserved across mammals Conserved across mammals 
## 4 Levels: Low-confidence Poorly conserved ... Conserved across vertebrates

2 Creating a KdModel object

KdModel objects are meant to be created from a table assigning a log_kd values to 12-mer target sequences, as produced by the CNN from McGeary, Lin et al. (2019). For the purpose of example, we create such a dummy table:

kd <- dummyKdData()
head(kd)
##         X12mer log_kd
## 1 AAAGCAAAAAAA -0.428
## 2 CAAGCACAAACA -0.404
## 3 GAAGCAGAAAGA -0.153
## 4 TAAGCATAAATA -1.375
## 5 ACAGCAACAAAC -0.448
## 6 CCAGCACCAACC -0.274

A KdModel object can then be created with:

mod3 <- getKdModel(kd=kd, mirseq="TTAATGCTAATCGTGATAGGGGTT", name = "my-miRNA")

Alternatively, the kd argument can also be the path to the output file of the CNN (and if mirseq and name are in the table, they can be omitted).

3 Common KdModel collections

The scanMiRData package contains KdModel collections corresponding to all human, mouse and rat mirbase miRNAs.

4 Under the hood

When calling getKdModel, the dissociation constants are stored as an lightweight overfitted linear model, with base KDs coefficients (stored as integers in object$mer8) for each 1024 partially-matching 8-mers (i.e. at least 4 consecutive matching nucleotides) to which are added 8-mer-specific coefficients (stored in object$fl) that are multiplied with a flanking score generated by the flanking di-nucleotides. The flanking score is calculated based on the di-nucleotide effects experimentally measured by McGeary, Lin et al. (2019). To save space, the actual 8-mer sequences are not stored but generated when needed in a deterministic fashion. The 8-mers can be obtained, in the right order, with the getSeed8mers function.



Session info

## R version 4.1.0 (2021-05-18)
## Platform: x86_64-w64-mingw32/x64 (64-bit)
## Running under: Windows Server x64 (build 17763)
## 
## Matrix products: default
## 
## locale:
## [1] LC_COLLATE=C                          
## [2] LC_CTYPE=English_United States.1252   
## [3] LC_MONETARY=English_United States.1252
## [4] LC_NUMERIC=C                          
## [5] LC_TIME=English_United States.1252    
## 
## attached base packages:
## [1] stats     graphics  grDevices utils     datasets  methods   base     
## 
## other attached packages:
## [1] scanMiR_0.99.26  BiocStyle_2.21.3
## 
## loaded via a namespace (and not attached):
##  [1] tidyselect_1.1.1       xfun_0.24              bslib_0.2.5.1         
##  [4] purrr_0.3.4            colorspace_2.0-2       vctrs_0.3.8           
##  [7] generics_0.1.0         htmltools_0.5.1.1      stats4_4.1.0          
## [10] yaml_2.2.1             utf8_1.2.1             rlang_0.4.11          
## [13] jquerylib_0.1.4        pillar_1.6.1           glue_1.4.2            
## [16] DBI_1.1.1              BiocParallel_1.27.2    BiocGenerics_0.39.1   
## [19] GenomeInfoDbData_1.2.6 lifecycle_1.0.0        stringr_1.4.0         
## [22] zlibbioc_1.39.0        Biostrings_2.61.1      munsell_0.5.0         
## [25] gtable_0.3.0           evaluate_0.14          labeling_0.4.2        
## [28] knitr_1.33             IRanges_2.27.0         GenomeInfoDb_1.29.3   
## [31] parallel_4.1.0         fansi_0.5.0            highr_0.9             
## [34] Rcpp_1.0.7             scales_1.1.1           BiocManager_1.30.16   
## [37] seqLogo_1.59.0         S4Vectors_0.31.0       magick_2.7.2          
## [40] jsonlite_1.7.2         XVector_0.33.0         farver_2.1.0          
## [43] gridExtra_2.3          ggplot2_3.3.5          digest_0.6.27         
## [46] stringi_1.7.3          bookdown_0.22          dplyr_1.0.7           
## [49] GenomicRanges_1.45.0   grid_4.1.0             tools_4.1.0           
## [52] bitops_1.0-7           magrittr_2.0.1         sass_0.4.0            
## [55] RCurl_1.98-1.3         tibble_3.1.2           crayon_1.4.1          
## [58] pkgconfig_2.0.3        ellipsis_0.3.2         data.table_1.14.0     
## [61] assertthat_0.2.1       rmarkdown_2.9          R6_2.5.0              
## [64] compiler_4.1.0