calculateMaxEntScanScore {ModCon} | R Documentation |
This function calculates the MaxEntScan score of either splice donor (SD) or acceptor sequences (SA).
calculateMaxEntScanScore(seqVector, ssType)
seqVector |
Character value of nucleotide sequence of a splice site sequence. SA sequences should be 23nt long (20 intronic, 3 exonic) and SD sequences should be 9nt long (3 exonic, 6 intronic). Only bases 'A', 'G', 'C', 'T' permitted. |
ssType |
Numeric value which indicates the type of splice site. Either '3' for an SA or '5' for an SD. |
Numeric vector stating the MaxEntScan score per splice site sequence entered with seqVector
calculateMaxEntScanScore('TTCCAAACGAACTTTTGTAGGGA',3) calculateMaxEntScanScore('GAGGTAAGT',5)