| splitseq {seqinr} | R Documentation |
Split a sequence into sub-sequences of 3 (the default size) with no overlap between the sub-sequences.
splitseq(seq, frame = 0, word = 3)
seq |
a vector of chars |
frame |
an integer giving the starting position to split the sequence |
word |
an integer giving the size of the sub-sequences |
This function returns a vector which contains the sub-sequences.
D. Charif
To have an overview of the seqinR's functionnality, please consult this vignette:
Charif, D., Lobry, J.R. (2005) SeqinR: a contributed package to the R project for statistical
computing devoted to biological sequences retrieval and analysis. Springer Verlag, Biological and Medical Physics/Biomedical Series, in preparation.
a=s2c("aacgttgcaggtcgctcgctacgtagctactgttt")
## To obtain the codon sequence in frame 0:
splitseq(a)