| invers {seqinr} | R Documentation |
Reverse a sequence. For example, "a","c","g","t" is transformed into "t","g","c","a".
invers(seq)
seq |
A vector of chars |
return a vector of character.
D. Charif
To have an overview of the seqinR's functionnality, please consult this vignette:
Charif, D., Lobry, J.R. (2005) SeqinR: a contributed package to the R project for statistical
computing devoted to biological sequences retrieval and analysis. Springer Verlag, Biological and Medical Physics/Biomedical Series, in preparation.
s=s2c("acgtgctcgtataatatgccc")
invers(s)