| count {seqinr} | R Documentation |
Counts the number of times dimer/trimer/etc nucleotides occurs in a sequence. Note that the oligomers are overlapping.
count(seq,word,frame=0)
seq |
a vector of chars |
word |
an integer giving the size of word (n-mer) to count |
frame |
an integer (0,1,2) giving the frame (starting position) |
count counts the occurence of all words by moving a window of
length word. The window step is always an unit. frame
controls the starting position in the sequence for the count.
This function returns a factor whose levels are all the possible oligonucleotids. All oligomers are returned, even if absent from the sequence.
D. Charif
To have an overview of the seqinR's functionnality, please consult this vignette:
Charif, D., Lobry, J.R. (2005) SeqinR: a contributed package to the R project for statistical
computing devoted to biological sequences retrieval and analysis. Springer Verlag, Biological and Medical Physics/Biomedical Series, in preparation.
a=s2c("acgggtacggtcccatcgaa")
##To count the occurences of dinucleotides of a:
count(a,2)
##To count the occurences of trinucleotides of a in frame 2:
count(a,3,2)