GC3                  package:seqinr                  R Documentation

_C_a_l_c_u_l_a_t_e_s _t_h_e _f_r_a_c_t_i_o_n_a_l _G_C_3 _c_o_n_t_e_n_t _o_f _n_u_c_l_e_i_c _a_c_i_d _s_e_q_u_e_n_c_e_s

_D_e_s_c_r_i_p_t_i_o_n:

     This calculates the fraction of G+C  in third position of the
     codon bases of the input nucleic acid sequence(s)

_U_s_a_g_e:

     GC3(seq)

_A_r_g_u_m_e_n_t_s:

     seq: any nucleic acid sequence

_V_a_l_u_e:

     It returns the fraction of GC3 as a numeric vector

_A_u_t_h_o_r(_s):

     D. Charif

_R_e_f_e_r_e_n_c_e_s:

     To have an overview of the seqinR's functionnality, please consult
     this vignette:  Charif, D., Lobry, J.R. (2005) SeqinR: a
     contributed package to the R project for statistical computing
     devoted to biological sequences retrieval and analysis. Springer
     Verlag, _Biological and Medical Physics/Biomedical Series_, in
     preparation. 

_E_x_a_m_p_l_e_s:

        s=s2c("agtctggggggccccttttaagtagatagatagctagtcgta")
        GC3(s)

