GC                  package:seqinr                  R Documentation

_C_a_l_c_u_l_a_t_e_s _t_h_e _f_r_a_c_t_i_o_n_a_l _G_C _c_o_n_t_e_n_t _o_f _n_u_c_l_e_i_c _a_c_i_d _s_e_q_u_e_n_c_e_s

_D_e_s_c_r_i_p_t_i_o_n:

     This calculates the fraction of G+C bases of the input nucleic
     acid sequence(s) It reads in nucleic acid sequences, sums the
     number of 'G' and 'C' bases and writes out the result as the
     fraction (in the interval 0.0 to 1.0) of the length of the whole
     sequence.

_U_s_a_g_e:

     GC(seq)

_A_r_g_u_m_e_n_t_s:

     seq: any nucleic acid sequence

_V_a_l_u_e:

     It returns the fraction of G+C as a numeric vector

_A_u_t_h_o_r(_s):

     D. Charif

_R_e_f_e_r_e_n_c_e_s:

      To have an overview of the seqinR's functionnality, please
     consult this vignette:  Charif, D., Lobry, J.R. (2005) SeqinR: a
     contributed package to the R project for statistical computing
     devoted to biological sequences retrieval and analysis. Springer
     Verlag, _Biological and Medical Physics/Biomedical Series_, in
     preparation. 

_E_x_a_m_p_l_e_s:

        s=s2c("agtctggggggccccttttaagtagatagatagctagtcgta")
        GC(s)

